In vitro evaluation of antioxidant and radioprotective properties of a novel extremophile from mud volcano: implications for management of radiation emergencies

Please download to get full document.

View again

of 8
16 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
A thermophilic bacterium, designated as RH 127, was isolated from mud volcano (Baratang Islands) of Andaman region, India (12°07′N 92°47′E/12.117°N 92.783°E) for the first time. Biochemical tests and 16S rRNA gene sequencing indicate that it belongs
Document Share
Document Tags
Document Transcript
  In vitro evaluation of antioxidant and radioprotective propertiesof a novel extremophile from mud volcano: implicationsfor management of radiation emergencies Atlar Singh Dhaker  • Rohit Marwah  • Rakesh Damodar  • Damodar Gupta  • Hemant Kumar Gautam  • Sarwat Sultana  • Rajesh Arora Received: 13 December 2010/Accepted: 17 March 2011   Springer Science+Business Media, LLC. 2011 Abstract  A thermophilic bacterium, designated as RH127, was isolated from mud volcano (Baratang Islands) of Andaman region, India (12  07 0 N 92  47 0 E/12.117  N92.783  E)forthefirsttime.Biochemicaltestsand16SrRNAgene sequencing indicate that it belongs to the genus  Geo-bacillus . The strain showed 98% confirmed 16S rRNA genesequence homology with  Geobacillus toebii.  The bacteriawas extracted in various solvent systems and three differentfractions prepared. In the present study, antioxidant andradioprotective activity of extracts (INM-7860, INM-7861,and INM-7862) of bacterium  G. toebii  (strain RH 127) wereevaluated. The fractions were evaluated for their introspec-tive comparison of the relative antioxidant efficiency. Theantioxidative activities, DPPH radical scavenging effects,hydroxyl radical scavenging effects, membrane protection,antihemolytic activity, and linoleic acid degradation effica-cies were assayed. INM-7861 and INM-7862 activatedNF- j B expression, as evidenced by reporter assay studies,and thereby contributed to overall radioprotective effect.INM-7862exhibitedbestresults.Thisstudyexplicitlyshowsthat the extracts of   G. toebii  have immense potential as aradiation countermeasure agent. Keywords  Antioxidant    Geobacillus toebii  (strain RH127)    Linoleic acid    Liposome    Radioprotective    NF- j B Introduction Extremophiles are organisms that thrive in physically orgeochemically extreme environments that are otherwisedetrimental to the majority of life on earth. Extremophilesare classified, according to the conditions in which theyexist, as thermophiles, hyperthermophiles, psychrophiles,halophiles, acidophiles, alkaliphiles, barophiles, and endo-liths [1]. Due to their ability to endure and survive in extreme environments, these organisms have developedmechanisms for producing high capacity biologically activecompounds (BAC) and have been the focus of attention fordiscovery of novel drugs. Some of the extremozymes,derived from such microbes, have been studied in detailindicating that they produce a variety of antibacterial,antifungal, antilarval, antiprotozoan, antialgal, anti-helminthic, and generally cytotoxic secondary metabolites[2], besides they can be genetically modified to produce entirely new, clinically relevant compounds [3]. Their ability to act as an anticancer agent is equally promising [4]. Thermophiles are the group of extremophiles that can sur-vive in high temperature conditions. Rather they thrive at rel-ativelyhightemperatures,i.e.between 45  C and 80  C (113  Fand176  F)[5].Theyhavebeenreportedtobeextremelyusefulfor humans with diverse industrial as well as clinical applica-tions. They have been exploited to date in many fields likebioremediation, bioleaching, and biomining [6].The thermophiles have received a lot of attention in therecent years. Thermophilic bacteria such as  Geobacillus ste-arothermophilus ,  Geobacillus thermocatenulatus ,  Geobacil-lus thermoleovorans ,  Geobacillus kaustophilus ,  Geobacillus A. S. Dhaker    R. Marwah    D. Gupta    R. Arora ( & )Radiation Biotechnology Group, Institute of Nuclear Medicineand Allied Sciences (Defence Research and DevelopmentOrganization; DRDO), Brig S. K. Mazumdar Marg,Delhi 110054, Indiae-mail: rajesharoradr@rediffmail.comR. Damodar    H. K. GautamInstitute of Genomics and Integrative Biology,Mall Road, Delhi 110054, IndiaS. SultanaDepartment of Toxicology and Medical Elementology,Jamia Hamdard, Hamdard Nagar, Delhi, 110062, India  1 3 Mol Cell BiochemDOI 10.1007/s11010-011-0792-7  thermodenitrificans ,  Geobacillus subterraneus ,  Geobacillusuzenensis ,  Geobacillus caldoxylosilyticus  and  Geobacillustoebii  related to the genus  Geobacillus  have been widelyisolated from geothermal and man-made environmentsthroughout the world [7]. Study of the exogenous natural antioxidant materialfrom microbes has been a hot topic for many researchgroups. In recent years, bacteria have been considered as asource of anti-oxidants [8–11]. In this study, we report the isolation of a bacteria from active mud volcano, identifiedas  G. toebii  (strain RH 127), which is a Gram positive,aerobic, spore forming, thermophilic bacterial species. Thisstrain thrives at a temperature of 65  C and above and wasisolated from the Baratang Islands of Andaman region,India (12  07 0 N 92  47 0 E/12.117  N 92.783  E). Such volca-noes have been the favorable sites for the evolution of thermophilic bacteria. The antioxidant and radioprotectiveactivity of the different fractionated extracts of   G. toebii was evaluated in vitro, in the present study. Materials and methods Bacterial strain and culture conditionsThe strain was isolated from the soil samples collectedfrom active, mud volcano at Baratang Islands of Andamanregion, India by soil enrichment method. Individual colo-nies were picked and purified by streaking on nutrient agarplate. The isolated strain was grown in 200 ml of nutrientbroth at 65  C, pH 7.5 for 48 h. For bulk preparation, activeseed culture, one percent, was added to a 5000 ml Erlen-meyer flask containing 2000 ml sterile media were kept onshaker at 150 rpm for 72 h.Identification and authentication of the bacterial sample 16S rRNA gene sequencing TotalDNApreparationwascarriedoutfromtheexperimentalstrain and amplification of 16S rRNA gene was performedusing universal primers fD1 (5 0 AGTTTGATCCTGGCTCA 3 0 ) and rP2 (5 0 ACGGCTACCTTGTTACGACTT 3 0 ).Amplified DNA was purified using QIAGEN PCR purifica-tion kit (QIAGEN, Germany) and was sequenced at TCGA(New Delhi, India). Similarity searches of the sequencesobtained were performed using BLAST algorithm of NCBI [12]. Biochemical characterization of RH 127All the biochemical tests were performed as per Bergey’smanual of determinative bacteriology [13].293T Cell culture conditionsBriefly, cells were maintained in high glucose Dulbeccomodified eagle medium (DMEM) supplemented with 10%fetal bovine serum, Penicillin G, and Streptomycin.Preparation of bacterial extractThe 72 h grown 2 l culture of experimental bacterial strainwas obtained and bacterial cells were harvested at8,000 9 g  for 25 min. After sonication of cell pellet, celldebris was removed by centrifugation at 15,000 9 g  for10 min at 4  C and supernatant was fractionated in differentorganic solvents in increasing order of polarity. Thesefractions were then dried by evaporating under reducedpressure (BUCHI Rotavapour R-134) and vacuum dried(Flexi dry Lyophilizer). INM-7860 was prepared by soni-cation of bacterial cell pellet and then dried by evaporatingunder reduced pressure and vacuum dried where as INM-7861 and INM-7862 is methanol:chloroform (2:1) andmethanolic extracts, respectively.Antioxidant activityThe antioxidant activity in aqueous phase was determinedusing the potassium ferricyanide reduction assay [14].Extracts were treated with potassium ferricyanide. Themixture was treated with trichloroacetic acid. To thesupernatant, ferric chloride was added and incubated at37  C for 10 min and the absorbance was recorded at700 nm. An increase in absorbance is indicative of increasein reducing power.DPPH radical scavenging activityRadical scavenging activity of plant extracts against stableDPPH (1,1-diphenyl-2-picryl hydrazyl radical) was deter-mined spectrophotometrically [15]. Radical scavenging activity was expressed as the volume of each extract(in microliters) required causing a 50% decrease inabsorbance at 517 nm as compared to the control (100%).Hydroxyl radical scavenging activity (site specific)The site-specific hydroxyl radical scavenging potential wasmeasured using the deoxyribose degradation assay [16]. Different concentrations of each of the bacterial extracts(INM-7860, INM-7861, and INM-7862) under investiga-tion were mixed with 2-deoxyribose and PBS and exposedto  60 Co-gamma radiation. FeSO 4  7H 2 O was used to gen-erate hydroxyl radicals. To the mixture, 2-deoxyribose andPBS was added followed by TBA. Absorbance wasrecorded at 532 nm. The decrease in absorbance at a Mol Cell Biochem  1 3  particular concentration indicated higher hydroxyl radicalscavenging potential with respect to control. The percent-age inhibition of degradation of deoxyribose or hydroxylradical scavenging potential was evaluated as follows:% Inhibition  =  (O.D. control  -  O.D. sample  /O.D. control )  9  100.Hydroxyl radical scavenging activity (non-sitespecific activity)The assay remains as that of site-specific except EDTA(100  l M) was also added as a part of reaction mixture.Protection of membrane against radiation damageSoy lecithin (phospholipid) and cholesterol (1:1 molarratio) were suspended in an appropriate amount of chlo-roform. A thin film was developed by complete evapora-tion of chloroform in a rotary evaporator (Buchi, Newcastle, USA) at 40  C. The film was subjected to hydrationin phosphate buffer saline (PBS, 0.1 M, pH 7.4) andincubated in a shaking water bath (40  C) for 4 h. The stock solution was then diluted with PBS (0.1 M, pH 7.4) to thefinal concentration (in terms of phospholipid content) [17].Different concentrations of each of the bacterial extracts(INM-7860, INM-7861, and INM-7862) were evaluated forthe levels of malondialdehyde, an end product of mem-brane degeneration. A radiation dose of 0.25 kGy at a doserate of 1.93 kGy/h was used and after exposure the sampleswere incubated for 1 h at 37  C. Equivalent volume of 10%TCA and 0.5% thiobarbituric acid in 0.025 M NaOH wereadded. The resultant mixture was then heated at 80  C for1 h in a water bath. A pink colored chromogen complexwas formed, readable at 535 nm.Antihemolytic activity against supra-lethal radiationinduced hemolysisErythrocyte suspensions were prepared in 0.14 M NaClsolution [18]. Effect of extracts on erythrocyte hemolysiswas determined by the method described [19]. The RBC suspension in PBS was treated with extracts and exposed toradiations (0.1 kGy). The reaction mixture was incubatedat 37  C. To determine percentage hemolysis, theabsorbance of the supernatant at 540 nm was recorded.Anti-hemolytic activity of INM-7860, INM-7861, andINM-7862 was evaluated in terms of membrane degener-ation or lipid peroxidation activity [20]. Linoleic acid degradation assayThe protection potential of the extracts INM-7860, INM-7861, and INM-7862 were studied against the peroxylradicals generated in the system containing linoleic acidemulsion [21]. The absorbance of the reaction mixture wasmeasured at 500 nm. Protection potential of linoleic aciddegradation of the extracts INM-7860, INM-7861, andINM-7862 were evaluated in the terms of percent inhibi-tion of linoleic acid degradation.NF- j B reporter assay293T cells (HEK cells), obtained from ATCC, USA wereused for the NF- j B (nuclear factor  j -B) reporter assay[22]. Cells were infected with Lenti NF- j B reporter con- jugated with  LacZ   (SA Biosciences, Frederick, MD, USA)and stable clones was obtained using puromycin selection(1  l g/ml). Cells were treated with increasing concentra-tions of INM-7860, INM-7861, and INM-7862 for 6 h at37  C to check activation of NF- j B. After incubation,media was replaced and attached cells were washed gentlywith phosphate-buffered saline followed by lysis of cells inlysis buffer [0.25 M Tris (2-amino-2-hydroxymethyl-pro-pane-1,3-diol), pH 8.0]. After lysis cleavage buffer (0.6 MNa 2 HPO 4  7H 2 O, 0.4 M NaH 2 PO 4  H 2 O, 0.1 M KCl,0.01 M MgSO 4  7H 2 O, pH 7) with beta mercaptoethanoland  ortho -nitro-phenyl- b -galactoside (ONPG) were addedfor the measurement of Lac-Z reporter at 420 nm. Results Isolation and characterization of bacteria Phenotypic and biochemical characters of RH 127  This bacterium is Gram-positive rods, aerobic, endosporeforming, thermophilic having optimum growth at 65  Cwith 7.4 pH. Sequence analysis of the 16S rRNA gene wascarried out for identification of the organism.The biochemical characteristics of the bacterium( G. toebii  RH 127) are summarized in Table 1.  Nucleotide sequence accession number  The DNA sequence of 16S rRNA, obtained in this study,has been deposited in the GenBank nucleotide sequencedatabase under accession number DQ863285. BLASTanalysis of 943 nt 16S rRNA sequence revealed 97%sequence identity to  G. toebii.  The phylogenetic analysis isshown in Fig. 1.Antioxidant activityAntioxidant activity of INM-7860, INM-7861, and INM-7862 (10–1000  l g/ml) was found to increase in a con-centration-dependent manner (Fig. 2). Analysis of results Mol Cell Biochem  1 3  showed that INM-7861 and INM-7862 exhibited almostsimilar electron donation potential, at the respective con-centrations whereas INM-7860 exhibited lesser electrondonation potential at all tested concentrations. Maximumantioxidant activity was observed at a concentration of 2000  l g/ml.  DPPH radical scavenging activity DPPH radical scavenging ability of INM-7860, INM-7861,and INM-7862 exhibited a dose-dependent increase withmaximum activity (35%, 44%, and 37%), respectively, at1500  l g/ml concentration (Fig. 3). Comparatively, INM-7861 exhibited higher DPPH radical scavenging potential,although INM-7860 exhibited higher DPPH radical scav-enging potential at lower test doses in the range of 25–100  l g/ml concentration.  Hydroxyl radical scavenging activity The maximal inhibition of degradation of 2-deoxy- D -ribosein site-specific assay of INM-7860, INM-7861, and INM-7862 was found to be 36%, 45%, and 31%, respectively, at1000  l g/ml (Fig. 4). On the other hand, INM-7860, INM-7861, and INM-7862 exhibited significant ( P \ 0.05) 31%,42%, and 38% non-site specific hydroxyl radical scav-enging activity, respectively, at 1000  l g/ml. Table 1  The biochemical characteristics of   Geobacillus toebii  strainRH 127Biochemical test ResultMethyl red test NegativeH 2 S production NegativeCatalase test PositiveArginine test PositiveGas production from glucose NegativeVoges Proskauer test NegativeIndole test NegativeGrowth on MacConkey agar NegativeAmylase test NegativeSelenium PositiveSugar utilizationInulin PositiveGlucose PositiveDextrose NegativeCellobiose Negative Fig. 1  ( i ) Phylogram showing the phylogenetic position of the strainRH 127 generated by alignment of 16S rRNA gene sequences usingClustal W and ( ii ) pairwise distance matrix of ribosomal genesequences of various species of Geobacillus showing the phylogeneticposition of strain RH 127Mol Cell Biochem  1 3  Membrane protection (liposomal system)The analysis of membrane protection activity of INM-7860,INM-7861, and INM-7862 in artificial membrane system(liposome)revealedsignificant( P \ 0.05)inhibitionoflipidperoxidation with increase in the concentrations (Fig. 5). Atconcentrations (10–25  l g/ml), INM-7860, INM-7861, andINM-7862 showed significant membrane protection activitybut at higher concentrations INM-7860 was found to besignificantly ( P \ 0.05) effective compared to INM-7862.At a concentration of 50  l g/ml, membrane protectionpotential of INM-7862 was comparable to INM-7860,whereasINM-7861wascomparabletoINM-7860at250  l g/ ml concentration. INM-7860, exhibited significantly( P \ 0.05) different membrane protection at concentrationsrange 100–1000  l g/ml as compared to INM-7862.Protection of erythrocytes againstradiation-induced lysisRadiation (0.1 kGy)-induced lysis of erythrocytes wasmonitored and efficacy was tested in the concentrationrange of 10–1000  l g/ml (Fig. 6). Nevertheless, INM-7861exhibited significantly higher ( P \ 0.05) protection atconcentrations ranging from 50 to 250  l g/ml as comparedto INM-7860 and INM-7862. The protective response of allthe extracts was almost similar in the lower ranges tested,i.e. 10–25  l g/ml concentration.Linoleic acid degradation assayIn the linoleic acid degradation assay, two kinds of stressviz, radiation (0.25 kGy) and CuSO 4  (2 mM) were used toinduce damage and protection was evaluated using ferrith-iocyanate method. INM-7862 exhibited significant( P \ 0.05) protection, as compared to INM-7861, against Fig. 2  Evaluation of reducing power of INM-7860, INM-7861, andINM-7862.Theabsorbanceat700 nmwasrecordedintriplicateandeachexperiment repeated thrice. The values are expressed as mean ±  S.D Fig. 3  Interaction of various concentrations of INM-7860, INM-7861, and INM-7862 with DPPH, the absorbance at 517 nm wasrecorded in triplicate and each experiment repeated thrice. The valuesare expressed as mean  ±  S.D Fig. 4  Evaluation of hydroxyl ion (OH • ) scavenging activity of INM-7860, INM-7861, and INM-7862, in terms of percent inhibition of 2-deoxy- D -ribose degradation. Experiments were performed intriplicate and repeated thrice. Control samples (0% inhibition)contained no drug. All the values are expressed mean  ±  S.DMol Cell Biochem  1 3
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks