Identification and characterization of a novel nitrilase from Pseudomonas fluorescens Pf5

Please download to get full document.

View again

of 13
10 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Nitrile groups are catabolized to the corresponding acid and ammonia through one-step reaction involving a nitrilase. Here, we report the use of bioinformatic and biochemical tools to identify and characterize the nitrilase (NitPf5) from Pseudomonas
Document Share
Document Tags
Document Transcript
  Identification and characterization of a novel splicevariant of gonadotropin a subunit in the common carp Cyprinus carpio Y. W ANG , W. H U *, W.-y. L IU , Y.-p. W ANG AND  Z.-y. Z HU State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology,Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, No. 7 Donghu South Road, Wuhan 430072, China(Received 25 September 2006, Accepted 16 May 2007) In this study, an alternative splicing transcript  GtH- a 291  was identified by RT-PCR, which is291 nt and exists not only in the pituitary but also in the ovary in common carp  Cyprinus carpio .The analysis of GtH- a 291 amino acid sequence by the SignalP server predicted that the ‘missingsegment’ might characterize as a signal peptide. In the secretion experiment, GtH- a 357 subunitcould be secreted out of HeLa cells while GtH- a 291 could not, which confirmed the prediction.Co-immunoprecipitation assay proved that GtH- a 291 subunit is able to interact with bothFSH- b  and LH- b  as GtH- a 357 does. This is the first report concerning an alternative splicingtranscript of a GtH  a  subunit. Further studies are necessary to elucidate the specific role of thisvariant in the regulation of gonadal development and sexual maturation.  # 2007 The AuthorsJournal compilation # 2007 The Fisheries Society of the British Isles Key words: alternative splicing; common carp; gonadotropin; signal peptide. INTRODUCTION Alternative splicing of pre-mRNAs is a powerful and versatile regulatory mech-anism that can exert quantitative control over gene expression and influencethe functional diversification of proteins (Black, 2003). Because of this, alterna-tive splicing contributes to major developmental decisions and also to the finetuning of gene function (Lopez, 1998). Alternatively spliced mRNA is also foundfrom the gene related to the reproduction process. For example, a gonadotropin-releasing hormone (GnRH) RNA splicing product has been identified in cul-tured GnRH neurons and mouse hypothalamus, as well as in the mutant hpg  mouse (Zhen  et al. , 1997). Son  et al.  (2003) also observed that the preciseexcision of intron A and the joining of exons of GnRH serves as a key regu-latory step in the synthesis of the GnRH prohormone. Alternatively splicedvariants of the follicles stimulating hormone (FSH) receptor gene are also present *Author to whom correspondence should be addressed. Tel. and fax:  þ 86 27 68780628; email:huwei@ihb.ac.cn  Journal of Fish Biology  (2007)  71,  1082–1094doi:10.1111/j.1095-8649.2007.01582.x, available online at http://www.blackwell-synergy.com 1082 # 2007 The AuthorsJournal compilation # 2007 The Fisheries Society of the British Isles  in the human testis (Song  et al. , 2002). Recent evidence indicates that thereexists a sexual dimorphic expression pattern of a splice variant of zebrafish  Danio rerio  (Hamilton) vasa during gonadal development (Krovel & Olsen,2004). To date, however, no alternatively spliced variant of gonadotropin(GtH)  a  mRNA has been identified.GtH is a pituitary glycoprotein hormone that regulates gonadal developmentin vertebrates. In mammals, FSH and luteinizing hormone (LH) from the pitu-itary gland, as well as chorionic gonadotropin (CG) from the placenta are cat-egorized as GtHs (Kamei  et al. , 2003). In teleosts, as in other vertebrates, thereare two forms of GtH, traditionally referred to as FSH and LH (Van DerKraak  et al. , 1998). GtHs are glycoprotein hormones composed of a common a  subunit and a hormone-specific  b  subunit, which confers its biological spec-ificity. The hormonal activity is expressed only after a non-covalent associationbetween these two subunits (Pierce & Parsons, 1981).As previously reported, only a single  a -subunit gene has been identified inthe human and bovine genomes (Fiddes & Goodman, 1981; Godine  et al. ,1982; Goodwin  et al. , 1983; Burnside  et al. , 1988), whereas a novel human gly-coprotein hormone  a  subunit-related gene was identified as glycoprotein- a 2(GPA2) based on unique sequence similarity to the  a  subunit of glycoproteinhormones (Hsu  et al. , 2002). Moreover, two  a  subunits have been reportedin some species including salmonids and goldfish  Carassius auratus  (L.) (Itoh et al. , 1990; Swanson  et al. , 1991; Gen  et al. , 1993; Kobayashi  et al. , 1997).In salmonid pituitary glands, there are two different active  a  subunits thatshare 72% identity in their amino acid sequence. Both salmonid  a  subunits,upon association with corresponding  b  subunits, give rise to functionally activeGtH (Suzuki  et al. , 1988; Itoh  et al. , 1990). In common carp, two highly similar357 bp  a  subunit cDNAs ( a 1 and  a 2, which share 96% identity) are composedof three exons (2, 3 and 4) and encoding 118 amino acids (Chang  et al. , 1988;Huang  et al. , 1992). Despite the homology, these two cDNAs are believed to bederived from different genes and encode proteins that differ in seven aminoacid residues, three in the signal peptide and four in the mature polypeptide(Huang  et al. , 1991).In this study, a new GtH  a  subunit transcript was discovered in commoncarp and its general physiological properties were determined. MATERIALS AND METHODS FISH Common carp used in the experiments were captured from a fish pond at the Insti-tute of Hydrobiology, Chinese Academy of Sciences in Wuhan, Hubei Province, duringthe spring of 2004. RNA EXTRACTION, CDNA SYNTHESIS AND REVERSETRANSCRIPTION PCR Pituitaries and ovaries of the common carp were collected prior to reproduction.Total RNA was extracted using the SV Total RNA Isolation System Kit (Promega,Madison, WI, U.S.A.). The first cDNA chain was obtained by reverse transcription GONADOTROPIN  a  SUBUNIT IN CARP  1083 #  2007 The AuthorsJournal compilation  #  2007 The Fisheries Society of the British Isles,  Journal of Fish Biology  2007,  71,  1082–1094  using a random primer. GtH  a  subunit cDNA was obtained by PCR using the follow-ing primers: P1: tttaagcttatgttttggacaagatatgc, P2: tttgaattcttaagacttatgatagtagcag. AGenAmp PCR System 9700 (Perkin Elmer, Waltham, MA, U.S.A.) was used withthe following programme: a pre-denaturation at 94 °  C for 5 min, 30 cycles of amplifi-cation (94 °  C for 30 s, 62 °  C for 30 s, 72 °  C for 40 s) and a final extension at 72 °  Cfor 5 min. The PCR products were separated with 1  5% agarose gel electrophoresis,purified with a glassmilk kit (MBI, Vilnius, Lithuania) and cloned into the pMD-18Tvector (Takara, Otsu, Shiga, Japan). After transformation, four clones [4, 14, 16 and25; Fig. 1(a)] were sequenced (Sangon, Shanghai, China). CONFIRMATION BY REVERSE TRANSCRIPTION PCR Another primer P1 9  gctggagcaattggatgtga was designed, with which only the novelsplice variant was obtained. Reverse transcription PCR (RT-PCR) was repeated withthe pituitary RNA using the different combinations of primers: P1 and P2, P1 9  andP2, and the mixture primers of P1, P1 9 , P2 in different proportion. P2 was as the samereverse primer, while P1 and P1 9  were both forward one. Further RT-PCR confirma-tion was made using the ovary RNA with the similar combination of primers. ThePCR programme was as follows: a pre-denaturation at 94 °  C for 5 min, 40 cycles of amplification (94 °  C for 30 s, 62 °  C for 30 s, 72 °  C for 1 min) and a final extensionat 72 °  C for 5 min. The PCR products were analysed with 2  0% agarose gel electropho-resis. The segment obtained in these experiments was confirmed by sequencing. SIGNAL PEPTIDE SEQUENCE PREDICTION Firstly, amino acid sequences of the both  a  subunit protein were analysed byprotein–protein blast (http://www.ncbi.nlm.nih.gov/BLAST/). The ‘missing segment’of the alternatively spliced version normally functions as part of the signal sequenceand the N-terminal part of the ‘normal’ mature  a  subunit protein. In order to identifythis important piece of information and check if this deletion destroys the signalsequence property, the two amino acid sequences were checked at the SignalP server(http://www.cbs.dtu.dk/services/SignalP/). EXPRESSION OF GTH  a  SPLICE VARIANT IN HELA CELLSAND WESTERN BLOT ANALYSIS GtH- a 291 cDNA and GtH- a 357 cDNA were digested from  pT- a 291  and  pT- a 357   andcloned into the expression vector pHM6 to form  pHM6- a 291  and  pHM6- a 357  . HeLacells were maintained in DMEM supplemented with 10% foetal bovine serum at 37 °  Cin a humidified atmosphere of 5% CO 2 . Each of cDNA expression constructs weretransfected into HeLa cells using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad,CA, U.S.A.). After 48 h of transfection, the medium and the cell lysate were collectedfor western blot analysis. The protein samples were separated by 15% SDS– polyacrylamide gel electrophoresis. The separated proteins were transferred to NCmembranes (Millipore, Billerica, MA, U.S.A.). The membranes were incubated withmonoclonal anti-HA antibody (Santa Cruz Technology, Santa Cruz, CA, U.S.A.) for2 h at room temperature. After reaction with peroxidase-conjugated immunopure goatanti-mouse IgG secondary antibodies (Pierce Biotechnology, Rockford, IL, U.S.A.),proteins were visualized with DAB kit (Zhongshan, Beijing, China). CO-IMMUNOPRECIPITATION Co-immunoprecipitation (Co-IP) was carried out in separate samples. Four eukary-otic expression vectors were constructed in the assay. The vectors  pHM6- a 291  and  pHM6- a 357   expressed a HA epitope tag N-terminally, and the  pCMV-FSH  b  and 1084  Y. WANG  ET AL. #  2007 The AuthorsJournal compilation  #  2007 The Fisheries Society of the British Isles,  Journal of Fish Biology  2007,  71,  1082–1094   pCMV-LH  b  vectors expressed a Flag-tag N-terminally. HeLa cells were maintained inDMEM supplemented with 10% foetal bovine serum at 37 °  C in a CO 2  incubator. PHM6- a 291/pCMV-FSH  b ,  pHM6- a 291 /  pCMV-LH  b ,  pHM6- a 357/pCMV-FSH  b  and  pHM6- a 357  /  pCMV-LH  b  plasmids were separately co-transfected into HeLa cells using Lipofect-amine 2000 Reagent (Invitrogen). The cultured supernatant was subsequently collected.Protein G beads coupled with monoclonal anti-HA (Santa Cruz Technology) was usedto co-immunoprecipitate the complex. Protein G beads without anti-HA was used asa negative control. All the co-immunoprecipitation procedures were performed accord-ing to the manipulation manual of ProFound   Mammalin Co-ImmunoprecipitationKit (Pierce). Monoclonal anti-HA antibody (mAb)-protein G-linked beads were usedto immunoprecipitate HA-tagged proteins from the extracts of transfected cells. The F IG . 1. Schematic summary of   GtH- a 291  and the analysis of alternative splicing region compared with  GtH- a 357  . (a) The schematic structure of   GtH- a 357   and  GtH- a 291 . The published  GtH- a 357   sequence wascomposed of exon 2, 3 and 4 and was 357 bp in size. In addition, the novel transcript GtH- a 291 wascomposed of exon 3, 4 and partial exon 2. Partial sequence (235 . . . 301) of the second exon of   GtH- a 357  was spliced out during the maturation of   GtH- a 291 . (b) The alternative splicing region of   GtH- a 291 began at 236 bp as GU and ended at the usual 384 AG, shares a common 3 9  intron/exon conjunctionsite with  GtH- a 357  . The novel intron begins at GU (236 nt) and ends at the end of AG (383 nt), hasa pyrimidine-rich region upstream 3 9  splice site and a conserved CUAAC branch point (310 nt). GONADOTROPIN  a  SUBUNIT IN CARP  1085 #  2007 The AuthorsJournal compilation  #  2007 The Fisheries Society of the British Isles,  Journal of Fish Biology  2007,  71,  1082–1094  precipitation profound was detected by western blot analysis using the monoclonalanti-Flag antibody (Stratagene, La Jolla, CA, U.S.A.). RESULTS IDENTIFICATION OF AN ALTERNATIVE SPLICINGTRANSCRIPT OF GTH  a  SUBUNIT As reported, the primary transcript of common carp GtH  a  subunit was1152 nt, comprising four exons (denoted as 1, 2, 3, and 4; 1 . . . 25, 203 . . . 301,384 . . . 573, 682 . . . 1152) and three introns (26 . . . 202, 302 . . . 383, 574 . . . 681)(Huang  et al. , 1991). The coding sequence was 357 nt in length, composedof three exons (2, 3, and 4; 208 . . . 301, 384 . . . 573, 682 . . . 754) and encoding118aa. The intron/exon scheme is shown in Fig. 1(a). In the present study,four GtH  a  clones were obtained by RT-PCR and sequenced.  GtH-( a 1)-16  was identical in size to the reported  GtH- a 1  (NCBI number: X56497), while GtH-( a 1)-25  was only 291 bp, and was thus named  GtH- a 291  [Fig. 2(a)]. Tomake sure the existence of the new transcript, the RT-PCR experiment wasrepeated and the  GtH- a 291  transcript was obtained again. After sequencealignment analysis with  GtH- a 357  ,  GtH- a 291  was found to lack 66 nt(236 . . . 301), therefore, it should be a novel alternative splicing transcript of  GtH- a 357   [Fig. 2(b)]. This splicing transcript  GtH- a 291  contains a partial exon2 (208 . . . 235) and shares a common 3 9  intron/exon conjunction site with  GtH- a 357   [Fig. 1(a)]. The novel intron begins at GU (236 nt) and ends at the end of intron 2 AG (383 nt) [Fig. 1(b)], it has a pyrimidine-rich region upstream 3 9 splice site and a conserved CUAAC branch point (310 nt), which completelyfollows the typical mRNA alternative splicing model in a eukaryotic (Horowitz &Krainer, 1994). THE NOVEL TRANSCRIPT GTH- a 291 IS EXPRESSED BOTHIN PITUITARY AND OVARY CELLS To compare the expression level of   GtH- a 291  with  GtH- a 357  , a  GtH- a 291 specific forward primer P1 9  was designed. The 5 9  ten nucleotides of P1 9  werethe same as the 19 to 28 nt of   GtH- a 357  , while the 3 9  ten nucleotides of P1 9 were same with the 95 to 104 nt of   GtH- a 357  , so it just spanned the ‘missingsegment’ [Fig. 3(a)]. By using the  pT- a 357   and  pT- a 291  as templates, primerP1 9  was confirmed very specific to  GtH- a 291  because only the  pT- a 291  butnot  pT- a 357   can be amplified if P1 9  and P2 were used as primers.In the pituitary, two completely different bands were obtained using P1 9  andP2, P1 and P2 according to the same PCR programme and was confirmed bysequencing. Furthermore, when a mixture of P1 and P1 9  in different propor-tions was used as the forward primers, results of RT-PCR was as following:when the ratio of P1 9  and P1 is  < 50, only  GtH- a 357   was detected; only whenthe ratio reached   50 could  GtH- a 291  be detected and the proportion began tobecome greater [Fig. 3(b)].A recent study reported the novel expression of GtH subunit genes in ovarycells of the gilthead sea bream  Sparus aurata  L., and GtH subunits are 1086  Y. WANG  ET AL. #  2007 The AuthorsJournal compilation  #  2007 The Fisheries Society of the British Isles,  Journal of Fish Biology  2007,  71,  1082–1094
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks