Identification and characterization of a novel mouse gene encoding a Ras-associated guanine nucleotide exchange factor: expression in macrophages and myocarditis elicited by Trypanosoma cruzi parasites

Please download to get full document.

View again

of 13
26 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Identification and characterization of a novel mouse gene encoding a Ras-associated guanine nucleotide exchange factor: expression in macrophages and myocarditis elicited by Trypanosoma cruzi parasites
Document Share
Document Tags
Document Transcript
  Identification and characterization of a novel mouse geneencoding a Ras-associated guanine nucleotide exchangefactor: expression in macrophages and myocarditiselicited by  Trypanosoma cruzi   parasites Ludmila R. P. Ferreira,* ,†,‡ Eduardo F. Abrantes, ‡ Cibele V. Rodrigues,* Braulia Caetano,* ,† Gustavo C. Cerqueira,* Anna Christina Salim, ‡ Luiz F. L. Reis, ‡ and Ricardo T. Gazzinelli* ,† *  Department of Biochemistry and Immunology, Institute of Biological Sciences, Federal University of Minas Gerais, Brazil;  † Centro de Pesquisas Rene´ Rachou, Oswaldo Cruz Foundation, Belo Horizonte, MG, Brazil; and  ‡  Ludwig Institute for Cancer Research, Sa˜o Paulo, SP, Brazil Abstract: The ability of   Trypanosoma cruzi   to ac-tivate macrophages is, at least in part, attributed tothe glycosylphosphatidylinositol-anchored mucin- like glycoproteins (GPI-mucins) expressed in thesurface of the trypomastigote stage of the parasite.The differential display reverse transcriptase-poly-merase chain reaction and the reverse Northernblot were used to study modulation of gene expres-sion in murine macrophages exposed to GPI-mu-cins and in cardiac tissues from mice infected with T. cruzi.  Among several cDNAs that were moreabundant in lanes corresponding to macrophagesstimulated with GPI-mucins as compared with rest-ing cells, we confirmed the differential expressionof A1, interleukin-18, and GPI  4. Some of thesegenes were also shown to have enhanced expres-sion in the cardiac tissue (DAP-12, A1, andGPI  4) from infected animals. The expression of GPI  4 was also enhanced in human monocytesstimulated with GPI-mucins or bacterial lipopoly-saccharides. The complete sequence of the GPI  4transcript and its gene including the 5   upstreamregion was defined. GPI  4 was encoded by a novel,single copy gene present in mouse as well as humangenomes and showed conserved homology to dif-ferent members of the guanine nucleotide exchangefactor family.  J. Leukoc. Biol.  72: 1215–1227;2002.  Key Words:  GPI-mucins    NF-   B    Ras-GEF     Toll-like receptors INTRODUCTION Chagas’ disease is caused by an obligate intracellular proto-zoan parasite, namely  Trypanosoma cruzi , and affects 20 mil-lions individuals in Latin America [1, 2]. Once acquired, theinfection is life-long. The acute phase is associated to parasitescirculating in the bloodstream, intense tissue parasitism, andvarious signs and symptoms including those related to myo-carditis. After resolution of the acute phase, the chronicallyinfected chagasic patients present subpatent parasitemia andlow tissue parasitism displaying the asymptomatic form of disease. The asymptomatic stage of chronic Chagas’ diseasemay evolve to a symptomatic stage characterized by enlarge-ment of the heart (cardiopathy) and gastrointestinal organs andsudden death [3, 4].The pathology observed in chronic chagasic patients wasinitially attributed to autoimmune responses [5]. However, it isnow believed that persistence of parasite is necessary for disease development [6]. Further, increased tissue parasitismhas been observed in cardiac and digestive tissue from symp-tomatic chagasic patients [7–9]. Thus, it is assumed that im-mune response against parasite antigens or parasite moleculesthat promote leukocyte recruitment and inflammation are im-portant components in the pathogenesis of Chagas’ disease. Infact, our previous studies show that molecules derived from  T.cruzi  trypomastigotes, named glicosylphosphatidyinositol-an-chored mucin-like glycoproteins (GPI-mucins) possess potentactivity in inducing the synthesis of proinflammatory cytokines[10], chemoattractant [11–13] molecules, as well as reactivenitrogen intermediates [14] by macrophages. More precisely,we showed that GPI-anchors, highly purified from GPI-mucins,contain a glycan core with four to eight hexosis in a 4.0mannose:2.5 galactose ratio and unsaturated fatty acids in the  sn- 2 position of the alkyl-acylglycerolipid [15] and trigger theToll-like receptor-2 (TLR-2) at subnanomolar concentrations[13, 16, 17].As determined by the high level expression of interferon-  (IFN-  )-inducible chemokines (e.g., IFN-inducible protein-10;monokine induced by IFN-  ; regulated on activation, normal Texpressed and secreted) and adhesion molecules (vascular celladhesion molecule-1 and fibronectin), the former cytokine also Correspondence: Dr. Ricardo T. Gazzinelli, Laboratory of Immunopathology,Centro de Pesquisas Rene´ Rachou, FIOCRUZ, Av. Augusto de Lima 1715,30190-002 Belo Horizonte, MG, Brazil. E-mail: ritoga@dedalus.lcc.ufmg.br Current address of Ludmila R. P. Ferreira: Department of Immunology andInfectious Diseases, Harvard School of Public Health, Building I, Rm 706, 665Huntington Avenue, Boston, MA 02115.Received August 4, 2002; revised August 24, 2002; accepted August 26,2002.  Journal of Leukocyte Biology  Volume 72, December 2002  1215  appears to play an important role in promoting the in fl amma-tory environment in the heart of animals infected with  T. cruzi [12, 13, 18] .  In fact, mice lacking the functional IFN-   genedisplay major changes in the CD4   T and CD8   T lympho-cytes composition of in fl ammatory in fi ltrates, as well as en-hanced tissue parasitism in the heart [19, 20].As GPI-mucins and IFN-   are potent stimulators of macro-phages, and these cells are a principal component in thein fl ammatory process in the chagasic heart [12, 18 – 20], wedecided to investigate the pattern of gene expression in mac-rophages activated by GPI-mucins and/or IFN-  . We alsointended to determine whether the genes induced in macro-phages are also modulated in the heart tissue of mice experi-mentally infected with  T. cruzi . mRNA populations of in fl am-matory macrophages cultured in the absence or presence of GPI-mucins and/or IFN-   were compared by the differentialdisplay reverse transcriptase-polymerase chain reaction(DDRT-PCR) [21, 22]. By using the reverse Northern blottechnique [23], we could con fi rm the differential expression of some genes in macrophages stimulated with GPI-mucins andIFN-   and in the heart tissue from mice experimentally in-fected with  T. cruzi . Among the differentially expressed tran-scripts, we found a novel, single-copy gene, which is highlyconserved in mouse and human genomes and encodes a puta-tive protein with homology to genes from a family of theguanine nucleotide-releasing factors [24 – 26]. MATERIALS AND METHODS Animals Male C3H/HeJ, C57BL/6, or CD1 mice, 6 – 7 weeks old, were obtained from theanimal house of Centro de Pesquisas Rene ´   Rachou (CPqRR-FIOCRUZ, BeloHorizonte, MG, Brazil) and were used as a source of in fl ammatory macrophagesand for in vivo experiments with the CL strain of   T. cruz i. The experimentsusing mice were performed according the FIOCRUZ guidelines for animalexperimentation and approved by the Institutional Ethical Committee. Parasites The CL strain [27] of   T. cruzi  was continuously maintained in Swiss Webster outbred mice and was used in all in vivo experiments.  T. cruzi  trypomastigoteblood forms were isolated by differential centrifugation of blood from acutelyinfected mice, counted, and used to infect new mice and obtain total RNA fromdifferent organs including the heart after infection with  T. cruzi . The Y strain[28] of   T. cruzi  was maintained in  fi broblast cultures and was used as parasitesource for puri fi cation of GPI-mucins. For the trypomastigote culture, L-929 fi broblasts were initially infected with blood trypomastigotes in a ratio of oneparasite per cell. The tissue culture trypomastigotes were continuously passedin L-929  fi broblast cultures. The infected cultures were maintained in Dul-becco ’ s modi fi ed Eagle ’ s medium (DMEM) containing 5% fetal calf serum(FCS) at 33 ° C in 5% CO 2 .  After 4 or 5 days of culture, the parasites werecollected daily and centrifuged at 40  g  at 4 ° C for 10 min for cellular debrisseparation, followed by another centrifugation at 700  g  at 4 ° C for 10 min. Theresulting pellet containing live trypomastigotes was used to purify GPI-mucins. Experimental infections C3H/HeJ mice (males; weight, 20 – 25 g) were infected intraperitoneally with5000 blood trypomastigotes of the CL strain. The level of parasitemia wasassessed daily using 5   l fresh blood drained from the animal tail and usingan optic microscope. Organs were removed at 20 days post-infection fromanimals displaying positive parasitemia and were used for RNA extraction. Puri fi cation of  T. cruzi  -derived glycoconjugates The GPI-mucins were isolated from  T. cruzi  trypomastigotes as describedpreviously [10, 15] using sequential organic extraction followed by hydropho-bic-interaction chromatography in an octyl-Sepharose column (AmershamPharmacia Biotech, Uppsala, Sweden) and elution with a propan-1-ol gradient(5 – 60%). In fl ammatory murine macrophages C3H/HeJ, C57BL/6, and CD1 mice were used as a source of in fl ammatorymacrophages. The animals were injected with 1.5 ml 3% thioglycolate me-dium, and the elicited peritoneal exudate cells were harvested in cold, serum-free RPMI by peritoneal lavage 4 days later. The medium used in themacrophage (MacMed) cultures consisted of RPMI 1640 (Life Technologies,Grand Island, NY) supplemented with 2 mM L-glutamine, 80   g/ml gentami-cin, and 10% heat-inactivated FCS. Macrophages were resuspended in Mac-Med at 2    10 6  /ml, and 10 ml was dispensed into 75 cm 3 bottles. After 4 hincubation at 37 ° C in 5% CO 2 , the cells were washed with phosphate-bufferedsaline (PBS) to remove nonadherent cells, and 10 ml MacMed was added toeach tissue-culture  fl ask. The macrophages were then cultured for 6 h withmedium alone, 20 ng/ml GPI-mucins, or 100 ng/ml lipopolysaccharide (LPS)in the presence or absence of 100 units/ml IFN-   as indicated. Primary human macrophages Human peripheral blood mononuclear cells were isolated from freshly col-lected buffy coats obtained from healthy, voluntary blood donors by Ficoll-Hypaque (Amersham Pharmacia Biotech) density gradient centrifugation. Iso-lated cells were resuspended at a concentration of 1    10 7 cells/ml inRPMI-1640 medium (Life Technologies), and 1 ml was added in 24-well platesand incubated for 1 h at 37 ° C. Nonadherent cells were removed by gentlepipetting, and the plastic adherent cells were rinsed with 1 ml RPMI [29]. Theremaining adherent cells were cultured in complete media supplemented with10% human AB plasma and 1% HEPES and were cultured for 7 days at 37 ° C.On day 7, the cells were stimulated with IFN-  (400 units/ml), GPI-mucins (20ng/ml), and/or LPS (400 ng /ml) for 6 h, rinsed with PBS, and used to isolatetotal RNA. The FIOCRUZ Ethical Committee approved the experiments usingprimary human macrophages. Murine T cell lines Murine T cell clones, speci fi c for the interphotoreceptor retinoid-bindingprotein and characterized as T helper cell type 1 (Th1) and Th2 clones, wereobtained as described previously [30] and kindly provided by Dr. Luiz VicenteRizzo (Department of Immunology, University of Sa  ˜  o Paulo, Brazil). Brie fl y,5  10 6 cells were cultured in DMEM supplemented with 10% FCS, 10  5 nM2-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), 2 mM L-glutamine,0.1 mM nonessential amino acids, and vitamins (Life Technologies) in theabsence (control) or presence (activated) of 2.0   g/ml phytohemagglutinin(PHA) and were harvested 24 h later for total RNA extraction and Northernblot analysis. Total RNA isolation For RNA isolation, macrophages or T cell lines were washed with cold PBSonce at 6 h or 24 h post-stimulation, and RNA was extracted as described byChomczynski and Sacchi [31]. For extraction of total RNA from organs fromuninfected or infected mice, tissue fragments were homogenized in Trizol (LifeTechnologies), and RNA was extracted as recommended. When necessary,genomic DNA was removed from total RNA by treatment with DNase I. DDRT-PCR In fl ammatory macrophages were cultured in medium alone or in the presenceof GPI-mucins and/or IFN-  , and total RNA was extracted at 6 h post-stimulation. The total RNA was then treated with DNase I to eliminatecontamination with genomic DNA. DNA-free, total RNA (200 ng) extractedfrom macrophage cultures was reverse-transcribed using 200 units Super-Script II RT (Gibco-BRL, Gaithersburg, MD) in a 20-  l reaction in  DEPC H 2 Ocontaining 25 pmoles dT 11 VC (V  A, C, or G)-anchored primer. The reactionmixture was incubated for 60 min at 42 ° C. One-tenth of the cDNA  fi rst-strand 1216 Journal of Leukocyte Biology  Volume 72, December 2002  http://www.jleukbio.org  reaction was added to 18   l PCR-labeling mix containing 0.2   Ci/  l[  32 P]dCTP, 2.5   M dT 11 VC, and 0.5   M of one of three short arbitraryprimers (p13: 5  -CTGATCCATG-3  ; p14: 5  -CTGCTCTCAA-3  ; p15: 5  -CT-TGATTGCC-3  ). PCR was performed at 95 ° C for 1 min and 40 cycles at 94 ° Cfor 30 s, 40 ° C for 2 min, and 72 ° C for 30 s, followed by 72 ° C for 5 min. ThePCR products (4   l) were fractionated through a 6% denaturing polyacrylam-ide-sequencing gel [21, 22]. After electrophoresis, the gel was exposed toKodak  fi lm for 2 – 8 h. As control, we ampli fi ed RNA samples after DNasetreatment and before reverse transcription. No DNA fragments were generatedfrom this reaction.A total of 30 differentially represented bands was recovered from thesequencing gel, eluted in water, and reampli fi ed using the same primers andPCR conditions as described above, except that no radioactive nucleotide wasincluded. Reampli fi ed products were cloned into pUC18 using the Kit Sureclone (Amersham Pharmacia Biotech). Cloned fragments were sequenced byautomated DNA sequencing (ABI 377; Applied Biosystems, Foster City, CA). Sequencing and sequence analysis Plasmids derived from at least two different colonies were sequenced onautomated DNA sequencers (ABI Prism, Applied Biosystems). Sequence ho-mology of the cloned cDNA fragments with known cDNAs was determinedusing the BLAST program at the National Center for Biotechnology Information(Bethesda, MD). Reverse Northern dot-blot The cDNA inserts recovered from DDRT-PCR gels were ampli fi ed by PCRusing M13 Rev and forward primers and were immobilized on nylon mem-branes (Hybond N, Amersham Pharmacia Biotech) in duplicates in two dif-ferent dilutions. We also immobilized a fragment corresponding to the glyc-eraldehyde 3-phosphate dehydrogenase (GAPDH) gene and ampli fi ed productof an empty plasmid as positive and negative controls, respectively. ComplexcDNA probes labeled with [  - 32 P]dCTP were made with 30   g total RNAusing the Superscript preampli fi cation system (Superscript transcriptase,Gibco-BRL) and oligo (dT) 12 – 18 (Gibco-BRL). The reaction was performed ina 30-  l  fi nal volume, and the RNA was then hydrolyzed by a 30-min incuba-tion at 65 ° C in the presence of 3   l 3 M NaOH. The mixture was neutralizedby adding 10   l 1 M Tris-HCl (pH 7.4), 3   l 2N HCl, and 9   l H 2 O.Unincorporated nucleotides were removed by passage through a G25 Sephadexcolumn (Boehringer Mannheim, Mannheim, Germany). Prehybridization, hy-bridization, and washes were performed as described by Church and Gilbert[32]. Blots were placed onto a phosphor screen for 1 day, and results wereanalyzed in a Phosphor Image (Molecular Dynamics, Sunnyvale, CA) andImageQuant software (Amersham Pharmacia Biotech). Northern blot analysis Total RNA samples (15   g/lane) were fractionated through a 1% denaturingagarose/formaldehyde gel and blotted onto nylon membranes (Amersham LifeSciences, Little Chalfont, UK). The blots were prehybridized and hybridized asdescribed by Church and Gilbert [32] with [  - 32 P]dCTP-labeled cDNA probesfor GPI  4 (376 bp), interleukin (IL)-18 (210 bp), DAP-12 (220 bp), and A1(405 bp) obtained from fragments cloned from DDRT-PCR. The expression of GPI  4 was also assessed with a probe obtained from a plasmid from the MAM6library IMAGE Consortium #2631273, containing 1169 bp cDNA fragmentthat included the 376-bp GPI  4 fragment. A probe for mouse GAPDH [33] wasused to ensure equal RNA loading. Southern blot analysis Genomic DNA was obtained from the tail of the C56BL/6 mouse or from thehuman  fi broblast cell line GM637. DNA (20   g) was digested with theindicated restriction enzymes (New England Biolabs, Beverly, MA), fraction-ated through a 0.8% agarose gel, and blotted onto a nylon membrane (HybondN, Amersham Pharmacia Biotech) as described [34]. Filters were prehybrid-ized and hybridized as described by Church and Gilbert [32] using the[  - 32 P]dCTP GPI  4 cDNA probes. RT-PCR Detection of GPI  4 as well as the housekeeping gene hypoxanthine-guaninephosphoribosyltransferase (HPRT) mRNAs were performed by RT-PCR under nonsaturated conditions. Total RNA was isolated from the organs of uninfectedor infected mice (20 days post-infection): heart, brain, lymph node, andmuscle. Total RNA from monocyte cultures was isolated 6 h post-stimulationwith IFN-   (400 units/ml), GPI-mucins (20 ng/ml), and/or LPS (400 ng /ml).Total RNA (1  g) from each organ or cell preparation was reverse-transcribed,and 2   l from a 20-  l  fi nal reaction was used as template in a 23-cycle PCRreaction using the following primers for the mouse GPI  4N: 5  -GCACCTG-GATGGACTTTTGT, 3  -GCCAAGCCTGTTGAGATGACGC; human GPI  4N:5  -GCACCTGGATGGACTTTTGT, 3  - TTTCCTACCACAGTGTTGCG; mouseHPRT: 5  -GTTGGATACAGGCCAAGACTTTGTTG, 3  -GATTCAACTTGC-GCTCATCTTAGG; human HPRT: 5  -CGAGATGTGATGAAGGAGATG, 3  -GGAACCAGTCCGTCATATTAGG. The results were visualized in a silver-stained 6% acrylamide gel [35]. Cloning of the full-length GPI  4 cDNA  The full-length sequence of the GPI  4 cDNA was deduced from blasting theavailable sequence against the mouse genome using the CELERA database asdescribed in Results below. Based on the deduced sequence, primers weredesigned for the RT-PCR cloning and sequence con fi rmation of the entireGPI  4 cDNA. The 5   upstream sequence and intron sequences were deducedfrom the CELERA database. Exon-intron boundaries were con fi rmed by thecDNA sequence. Primers used in RT-PCR and for sequencing were as follows:5  -TCGACCCTTCCCGGTCCTGA-3  , 5  -CTCAGCAATGTTTGACAGCA-3  ,5  -TGGAAGCCCTTATCCAACAC-3  , 5  -TCCGGGACGAGAGAATGATG-3  ,and 5  -ACGGAAGAAAACACGGAACT-3   (forward primers) and 5  -CAG-CAGCAGCATTTTCCAGA-3  , 5  -AAGGGGATGTCTGCAGTAGA-3  , 5  -CC-CCAAGACCCTTAAAGTCA-3  , and 5  -CAACTTGGAGACAGGCCAAG-3  (reverse primers). RESULTSDifferential mRNA expression by macrophagesactivated with GPI-mucins and/or IFN-  In fl ammatory macrophages were cultured in medium alone or in the presence of GPI-mucins and/or IFN-  , and total RNAwas extracted at 6 h post-stimulation. DNA-free, total RNA wasused as template for the synthesis of cDNA using the primer T 11 VC. The cDNA was then ampli fi ed by PCR using the T 11 VCand the arbitrary primers 13, 14, or 15 of 10 nucleotide-longand radioactive nucleotide. PCR products obtained from cDNApreparations derived from macrophage exposed to differentstimuli were then compared in a sequencing gel (6% of acryl-amide). Although many different bands could be visualized, weselected and excised 30 bands from the sequencing gel. Asshown in  Figure 1  and  Table 1 , selected bands were fromunstimulated macrophages ( fi ve bands), from macrophagesstimulated with GPI-mucins (13 bands), with IFN-   (sevenbands), or with IFN-   plus GPI-mucins ( fi ve bands). ThesecDNAs were eluted from the gel, reampli fi ed, used to preparethe DDRT-PCR, cloned, and sequenced (Table 1). Differential expression of DAP-12, IL-18, and A1by GPI-mucins stimulated macrophages andheart tissue from mice infected with  T. cruzi  To con fi rm the differential expression of the genes encoded bythe 30 DNA fragments mentioned above, we used the reverseNorthern blot (RNB) analysis. The results are shown in  Figure2A  and Table 1. Each of the plasmids containing the DNAfragments cloned from the DDRT-PCR gel was spotted in twodifferent concentrations on four nylon membranes. Each mem-brane was hybridized with radioactive-labeled  fi rst-strand Ferreira et al.  Differential gene expression during chagasic myocarditis 1217  cDNA obtained from unstimulated macrophages (top left), GPI-mucin-stimulated macrophages (top right), cardiac tissue fromuninfected animals (bottom left), or cardiac tissue from mice at20 days post-infection (bottom right).To con fi rm the results of differential expression obtained inthe RNB, we performed a conventional Northern blot using four ampli fi ed cDNA as probes. The results are shown in Figure 2Band reveal that DNA fragment #2 (DAP-12) strongly hybridizeswith RNA derived from unstimulated and stimulated macro-phages. In contrast, only heart tissue from infected mice ex-pressed high levels of DAP-12 mRNA. As DAP-12 is a CD3analog expressed by myeloid cells including macrophages [36],we assume that the high levels of DAP-12 expression in thecardiac tissue are a re fl ection of macrophage migration to theheart from mice infected with  T. cruzi.  The DNA encoding afragment of the IL-18 gene (#16, Table 1) strongly hybridizedwith RNA from stimulated macrophages but not with RNA fromunstimulated macrophages or from cardiac tissue of control or infected mice, although the latter RNA samples had a sizedistribution that allows detection of IL-18 mRNA.Radioactive-labeled DNA encoding fragments 28 (GPI  4)and 30 (A1) hybridized with RNA preparations obtained fromGPI-mucin-stimulated macrophages and cardiac tissue frommice at 20 days post-infection with  T. cruzi.  Low hybridizationlevels were observed with RNAs obtained from unstimulatedmacrophages or cardiac tissue from noninfected animals. A1 isa previously reported gene from the bcl-2 gene family thatencodes an antiapoptotic protein and is shown to be elicitedduring infection with the protozoan parasite  Toxoplasma gondii [37, 38]. The DNA fragment 28 was found to encode a se-quence present within an expressed sequence tag (EST) fromthe IMAGE Consortium (gb  AW413376.1  ) but not related toany known gene. Therefore, we decided to investigate andcharacterize the putative gene encoded by the fragment 28,named GPI  4 here. Differential expression of GPI  4 by activatedmurine macrophages First, we con fi rmed that GPI  4 was expressed by macrophagescultured under different conditions. The differential expressionof GPI  4 mRNA in macrophages exposed to GPI-mucins (or LPS) and/or IFN-  was con fi rmed by Northern blot analysis. Asshown in  Figure 3A , low levels of GPI  4 mRNA were ex-pressed by in fl ammatory macrophages C3H/HeJ (hyporespon-sive to LPS) cultured in medium alone. A small increase inexpression of GPI  4 mRNA was observed when macrophagesfrom C3H/HeJ were cultured in the presence of IFN-  . Inmacrophages from C3H/HeJ mice stimulated with GPI-mucins,we observed a  fi vefold increase of GPI  4 mRNA expression.Similar results were obtained when in fl ammatory macrophagesfrom C57BL/6 mice were stimulated with GPI-mucins (Fig. 3,B and C) or macrophages from CD1 mice stimulated with LPS(Fig. 3D). The expression of GPI  4 mRNA by macrophagesexposed to GPI-mucins was already noticeable at 2 h andpersisted up to 24 h post-stimulation (Fig. 3C). In most exper-iments, IFN-  was shown to have a weak or no effect on GPI  4mRNA expression. In contrast, the ability of IFN-  to enhancethe GPI  4 mRNA expression elicited by GPI-mucins or LPSwas always evident (Fig. 3, A, B, and D). As control, wehybridized these same  fi lters with a probe containing a frag-ment of the murine GADPH gene. The hybridization with theGAPDH probe showed that different samples of RNA werequite homogeneous. Finally, we showed that expression of GPI  4 mRNA was not restricted to macrophages and thatenhanced expression of this unknown gene was also enhancedin Th1 or Th2 murine cell clones activated with mitogen (Fig.3E). Expression of GPI  4 mRNA was not observed in the sameclones of Th lymphocytes that were not activated with mitogen.These results clearly link the expression of GPI  4 mRNA withthe activation stage of macrophages and T lymphocytes. In vivo expression of GPI  4 mRNA and detectionof the GPI  4 gene in the mouse genome We also investigate the ability of   T. cruzi  parasites to trigger expression of GPI  4 mRNA in vivo. C3H/HeJ mice wereinfected with 5000 trypomastigotes from the CL strain of   T.cruzi  and parasitemia followed from day 1 to day 20 post-infection (data not shown). Different organs (i.e., brain, heart, Fig. 1.  Differential display of mRNAs from macrophage control (not stimu-lated; a), stimulated with GPI-mucins (b), stimulated with IFN-   (c), or stimulated with IFN-   plus GPI-mucins (d). In fl ammatory macrophages wereisolated from C3H/HeJ mice after 4 days of thioglycolate injection, washed,and transferred to small tissue-culture  fl asks. After removal of nonadherentcells, a monolayer was incubated for 6 h with medium alone (control), GPI-mucins (2 nM), IFN-   (100 units/mL), or GPI-mucins (2 nM) plus IFN-   (100units/mL). The puri fi ed RNA (0.2   g), obtained from each macrophage pop-ulation, was reverse-transcribed with T 11 VC primers, and an additional shortarbitrary primer (p13: 5  -CTGATCCATG-3  ; p14: 5  -CTGCTCTCAA-3  ; p15:5  -CTTGATTGCC-3  ) was used for the PCR reaction as described in Materialsand Methods. Radiolabeled PCR products were then fractionated in a sequenc-ing gel. DNA fragments that appear to be differentially expressed are markedby arrows and numbered. 1218 Journal of Leukocyte Biology  Volume 72, December 2002  http://www.jleukbio.org  intestine, kidney, liver, lung, lymph node, muscle, spleen, andthymus) were collected from mice at days 0 (uninfected con-trols) and 20 post-infection, and part of each organ was used for total RNA extraction for Northern blot or RT-PCR analysis.Our results showed no level or low levels of constitutive ex-pression of GPI  4 mRNA in the heart, lung, lymph nodes, andthymus ( Fig. 4, A  and  B ). High levels of constitutive expres-sion of GPI  4 mRNA were observed in the brain, intestine(Fig. 4A), and testis (not shown) of noninfected mice andpersisted in infected mice. Enhanced expression of GPI  4mRNA was observed in the kidney, liver, spleen, and thymusfrom animals at day 20 post-infection (Fig. 4A). The RT-PCRcon fi rmed some of these results, showing that heart and lymphnodes from three infected animals had enhanced GPI  4 ex-pression when compared with the same organs from uninfectedanimals (Fig. 4B). We did not detect a GPI  4 expression inmuscle tissue (Fig. 4, A and B). The presence of this sequencein the mouse genome was con fi rmed by Southern blot analysis.Figure 4C shows that the GPI  4 probe hybridizes with agenomic fragment in DNA digested with  Xba I,  Hin dIII,  Apa I,or   Eco RI, indicating that GPI  4 is encoded by a single copygene. Isolation and characterization of the completecDNA, the corresponding GPI  4 murine gene As described above, fragment 28 (Fig. 1 and Table 1) is a376-bp cDNA fragment that was more prominent in a lanecorresponding to macrophages treated with GPI-mucins plusIFN-  . GPI  4 was cloned and sequenced, revealing identityto an already deposited EST (IMAGE Consortium MAM6,AC #gb  AW413376.1  ). We obtained the correspondingplasmid and sequenced 1169 bp that contain the complete376 bases of fragment 28. In silico analysis of the 1169-bpfragment revealed a potential open reading frame that wasopened on its 5   end. A predictable human ortholog (AC#BAB71130) was identi fi ed against in the NCBI database,its encoding RNA (AC #AK056257) was mapped on theCELERA human genome database, and the predicted genestructure and exon-intron boundaries were de fi ned. In par-allel, we blasted the 1169 bp against the CELERA mousegenome database and identi fi ed the genome sequence inwhich this cDNA is encoded. The exon-intron structurededuced for the human gene was used to de fi ne the exon-intron structure of the mouse gene. TABLE 1. cDNA Fragments from DDRT-PCR, Their Sequence Deposited in Nonredundant and EST GenBank Data,and Assessment of Their Expression by Reverse Northern Blot AnalysisDDRT-PCRclone #RNBlocationLength(bp) Sequence homologyAccessionnumber Normalized expression ratioM   GPI/M  controlInf. heart/un. heart1 A5/6 465 Selenophosphate synthase 2 NM_009266 1.19 1.23B3/42 B1/2 220 DAP-12 NM_011662.1 0.79 4.53 C1/2 88 EST AU259112 1.20 1.114 D1/2 349 Nuclear protein 220 NM_008717 0.94 1.635 C9/10 224 Nuclear protein 220 NM_008717 1.20 1.897 G1/2 180 EST BC012869 1.34 1.028 G3/4 205 pMEM2 X95350 1.14 0.779 F11/12 181 EST AI466933 1.0 1.3710 D3/4 165 EST AA261689 1.13 1.6611 E5/6 135 Annexin A7 XM_122667 1.46 1.4312 E3/4 134 Mouse homologue of transcriptional regulator RPD3U31758 1.20 1.2116 B11/12 210 Interleukin-18 NM_008360 2.81 1.4817 C3/4 311 Moesin XM_125427 0.99 1.4018 F1/2 108 EST BB778505 1.25 1.2520 D9/10 125 EST BE376077 1.48 1.4921 F9/10 121 EST BC020437 1.50 1.4622 B5/6 115 EST BF462008 1.29 1.2023 D5/6 258 Regulator of G-proteinsignaling 2NM_009061 0.27 1.3724 E7/8 182 EST Bankit481633 1.63 1.4225 E9/10 232 EST BM199868 1.10 1.2826 D7/8 263 Prolyl oligopeptidase NM_011156 1.62 1.6827 A11/12 259 EST AI197278 1.72 1.7528 F3/4 376 EST AW413376 2.46 2.2130 C7/8 405 Hemopoietic-speci fi c early-response protein (A1)L16462 6.16 2.37 From the 30 cDNAs cloned, the sequences of clones 6 (F5/F6), 13 (G5/G6), 14 (D11/D12), 15 (E11/E12), 19 (A7/A8), and 29 (B7/B8) were not con fi rmed andare not shown. Control empty plasmids were spotted in different locations of the membrane (A9/10, B9/10, C5/6, C11/12, E1/2, and F7/8). Numbers within theparenthesis indicate the RNB location. Inf., Infected; un., uninfected. Ferreira et al.  Differential gene expression during chagasic myocarditis 1219
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks