Exudative age-related macular degeneration (AMD) and. b2 Adrenergic Receptor Antagonism Attenuates CNV Through Inhibition of VEGF and IL-6 Expression

Please download to get full document.

View again

of 10
4 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Biochemistry and Molecular Biology b2 Adrenergic Receptor Antagonism Attenuates CNV Through Inhibition of VEGF and IL-6 Expression Jeremy A. Lavine, 1 Mitra Farnoodian, 1 Shoujian Wang, 1 Soesiawati R.
Document Share
Document Transcript
Biochemistry and Molecular Biology b2 Adrenergic Receptor Antagonism Attenuates CNV Through Inhibition of VEGF and IL-6 Expression Jeremy A. Lavine, 1 Mitra Farnoodian, 1 Shoujian Wang, 1 Soesiawati R. Darjatmoko, 1 Lynda S. Wright, 1 David M. Gamm, 1,2 Michael S. Ip, 1,2 Christine M. Sorenson, 2 and Nader Sheibani 1,2 1 Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, Wisconsin, United States 2 McPherson Eye Research Institute, University of Wisconsin, Madison, Wisconsin, United States Correspondence: Nader Sheibani, Department of Ophthalmology and Visual Sciences, University of Wisconsin, 1111 Highland Avenue, 9453 WIMR,Madison,WI53705,USA; Submitted: June 27, 2016 Accepted: December 19, 2016 Citation: Lavine JA, Farnoodian M, Wang S, et al. b2 adrenergic receptor antagonism attenuates CNV through inhibition of VEGF and IL-6 expression. Invest Ophthalmol Vis Sci. 2017;58: DOI: / iovs PURPOSE. The role of b adrenergic receptor (AR) signaling in neovascular ocular diseases has recently emerged. We have previously reported that intraperitoneal propranolol inhibits choroidal neovascularization (CNV) in vivo and b2-ar blockade reduces vascular endothelial growth factor (VEGF) expression in mouse retinal pigment epithelium and choroidal endothelial cells in culture. Here we tested the hypothesis that the b2-ar regulates CNV through modulation of VEGF and inflammatory cytokine expression. METHODS. Mice were subjected to laser burns, inducing CNV, and were treated with an intravitreal b2-ar antagonist. After 3 and 5 days, total eye interleukin-6 (IL-6) and VEGF protein levels were measured, respectively. After 14 days, CNV was measured on choroidal scleral flatmounts. The effects of b-ar signaling on VEGF and IL-6 expression were investigated in various mouse retinal and human RPE cells by using specific b-ar agonists and antagonists. RESULTS. b2 Adrenergic receptor signaling increased Vegf mrna expression by approximately 3- to 4-fold in mouse retinal microglia and pericytes in culture. b2 Adrenergic receptor signaling upregulated IL-6 mrna expression between 10- and 60-fold in mouse retinal microglia, pericytes, RPE, and choroidal endothelial cells in culture. Intravitreal injection of b2-ar antagonist ICI 118,551 reduced CNV by 35% and decreased IL-6 protein levels by approximately 50%. In primary human RPE cells, b2-ar activation also stimulated VEGF and IL-6 mrna expression by 2- and 10-fold, respectively. CONCLUSIONS. Anti-VEGF therapy for CNV is highly effective; however, some patients are resistant to therapy while others undergo repeated, frequent treatments. b2 Adrenergic receptor signaling is a potential therapeutic target because of its angiogenic and inflammatory properties. Keywords: adrenergic antagonists, choroidal neovascularization, interleukin-6, VEGF Exudative age-related macular degeneration (AMD) and diabetic retinopathy are leading causes of severe visual disability. Inhibition of vascular endothelial growth factor (VEGF) is the mainstay of treatment for both neovascular AMD 1,2 and diabetic macular edema (DME). 3,4 Despite these significant advances, several challenges remain in the treatment of both exudative AMD and DME. First, many patients require frequent and repeated intravitreal injections. Second, anti-vegf treatment is possibly associated with systemic thromboembolic events 5,6 and local adverse events including RPE tears 7 and endophthalmitis. 8 Third, some patients demonstrate resistance or tachyphylaxis toward anti-vegf medications. Lastly, a small minority of patients do not respond to anti-vegf therapy alone. These limitations have sparked investigations into new therapeutics targets and new modalities for inhibition of neovascularization. Propranolol, a nonspecific b adrenergic receptor (b-ar) antagonist, has become the gold standard for treatment of severe hemangioma of infancy. 9 Tumor regressive properties from propranolol treatment stem from its ability to inhibit VEGF expression. 10 Additionally, b2-ar signaling stimulates angiogenesis in chronic ischemia 11 and propranolol inhibits endothelial tubulogenesis. 12 These findings have resulted in research into the utility of b-ar antagonism in retinal neovascular diseases. In the oxygen-induced ischemic retinopathy (OIR) mouse, both propranolol treatment and specific b2- AR blockade cause reduced retinal neovascularization and VEGF expression. 13,14 In retrospective clinical investigations, b- blocker treatment is correlated with reduced numbers of anti- VEGF injections in exudative AMD 15 and fewer laser procedures in diabetic retinopathy. 16 Recently, in patients with persistent retinal fluid despite maximal anti-vegf therapy for exudative AMD, topical timolol-dorzolamide treatment in addition to anti-vegf therapy improved retinal fluid. 17 These studies led us to investigate the role of b-blockers in a laserinduced CNV model. In our prior study, 18 we have found that intraperitoneal propranolol treatment reduces CNV area by 50%, and specific b2-ar blockade decreases VEGF expression in mouse choroidal endothelial and RPE cells in culture. In the current follow-up study, we sought to determine if specific intravitreal b2-ar blockade inhibits CNV in mice. We next investigated the role of b-blocker treatment in the expression of VEGF and inflammatory cytokines in mouse retinal microglia, retinal pericytes, and choroidal endothelial and RPE cells in culture. And finally, we extended these results to human fetal RPE cells in culture. iovs.arvojournals.org j ISSN: This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. b2-adrenergic Receptor and Exudative AMD IOVS j January 2017 j Vol. 58 j No. 1 j 300 TABLE 1. Reagents Used in Cell Culture Experiments Target Drug Vehicle Dose K b1, nm K b2, nm K b3, nm Source Catalog No. Nonselective agonist Norepinephrine HCl 10 lm Sigma A7257 Nonselective antagonist Propranolol Water 1 lm Sigma P0884 b1-ar antagonist CGP Water 1 lm x 1000x Tocris 1024 b2-ar antagonist ICI 118,551 Water 100 nm Tocris 0812 b3-ar antagonist SR 59230A Water 100 nm Tocris 1511 b1-ar agonist Xamoterol Water 100 nm Tocris 0950 b2-ar agonist Formoterol Water 100 nm Tocris 1448 b3-ar agonist BRL Water 1 lm Tocris 0948 MATERIALS AND METHODS Reagents Norepinephrine (NE) and propranolol were purchased from Sigma-Aldrich Corp. (St. Louis, MO, USA). Specific b-ar agonists and antagonists were purchased from Tocris (R&D Systems, Minneapolis, MN, USA). Table 1 summarizes the catalog numbers, concentrations, and vehicles used for each compound. The inhibition and activation constant concentrations (K) are also provided. The used concentrations in this study were chosen to maximize specific inhibition of each receptor. Animals All research using mouse models of CNV was carried out in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and was approved by the Institutional Animal Use and Care Committee of the University of Wisconsin School of Medicine and Public Health. Wild-type 6-week-old female C57BL/6j mice were housed on a 12-hour light dark cycle and provided with food and water ad libitum. Laserinduced CNV experiments were performed as previously described. 19 Briefly, 15 female mice were anesthetized and treated with three focal laser burns in each eye (30 retinas treated per group, 90 total burns per group). ICI 118,551 was dissolved in saline and delivered once approximately 30 minutes after laser treatment via intravitreal injection of 2 ll (mouse vitreous is 10 ll) for a final dose of 0.03 lg per eye. Each mouse was treated in both eyes with either vehicle saline or ICI 118,551 dissolved in saline. This was done so that systemic absorption of drug would not confound the results if each eye was treated differently. After 14 days, mice were killed and CNV was measured on choroidal scleral flatmounts (29 control, 27 treated, 4 were excluded owing to intravitreal injection complications) by using intercellular adhesion molecule-2 (ICAM-2; BD BioSciences, San Jose, CA, USA) immunofluorescence staining. Images were analyzed with ImageJ software ( provided in the public domain by the National Institutes of Health, Bethesda, MD, USA). Each eye was treated as an individual experimental unit because of the variance associated with intravitreal injection. Isolation and Culture of Choroidal and Retinal Endothelial Cells, Pericytes, Astrocytes, and RPE Cells Choroidal endothelial, 18 RPE cells, 18 retinal endothelial cells, 20 retinal astrocytes, 21 and pericytes 22 were isolated and cultured as previously described by us. All experiments were performed on cells between passage 5 and passage 15. All cells were maintained at 338C with 5% CO 2. All cells except for retinal pericytes were cultured on 1% gelatin-coated 60-mm dishes. Cells were not allowed to grow beyond 20 passages. Before experiments, cells were serum starved overnight in serum-free medium. Serum-free medium was identical to growth medium described previously except it lacked 10% FBS. Isolation and Culture of Human Fetal RPE Cells Human fetal eyes were obtained from University of Washington Birth Defects Laboratory. Human fetal RPE cells were isolated as previously described. 23 Human fetal RPE cells were cultured by DMG s laboratory in 70% Dulbecco s modified Eagle s medium containing 4.5 g/l D-glucose (catalog No ; Invitrogen, Carlsbad, CA, USA), 30% F12 nutrient mixture containing L-glutamine (catalog No ; Invitrogen), 1% antibiotic antimycotic solution (catalog No ; Invitrogen), and B27 (50X solution, catalog No ; Invitrogen). Human fetal RPE cells were at passage 2 to 3. Cells were transferred to NS s laboratory where they were cultured at 378C with 5% CO 2. Cells were not serum starved overnight, as they are cultured without serum. Human fetal RPE cells were treated with b-adrenergic agonists for 2 hours. RNA was extracted by using the Trizol RNeasy Plus Mini Kit (Qiagen, Valenica, CA, USA). Synthesis of cdna and quantitative PCR was performed identically as for various mouse cells (see Table 2 for primers). Messenger RNA Analysis For mrna analysis, cells were preincubated with b-ar antagonists for 30 minutes before incubation with b-ar agonists for 2 hours in 24-well plates. Cells were then washed with 1X phosphate-buffered saline (PBS; Sigma), lysed in RLT plus (a guanidine-rich buffer; Qiagen), and frozen at 208C. FIGURE 1. b2 Adrenergic receptor blockade attenuates CNV formation in mice. Mice were given a single intravitreal injection of saline (veh) or b2-ar antagonist (ICI-118,551, 0.03 lg per eye) on the same day as laser treatment. Choroidal neovascularization area was measured by ICAM-2 staining after 14 days (N ¼ 27 29, **P 0.01). b2-adrenergic Receptor and Exudative AMD IOVS j January 2017 j Vol. 58 j No. 1 j 301 FIGURE 2. Norepinephrine increases VEGF expression in retinal microglia and pericytes. (A) Mouse retinal microglial cells, pericytes, astrocytes (RASTs), and endothelial cells (RECs) were incubated with vehicle (veh) or 10 lm NE for 2 hours. Vascular endothelial growth factor expression was measured by quantitative PCR (N ¼ 4 7, *P 0.05, **P 0.01). (B D) b1 Adrenergic receptor, b2-ar, and b3-ar expression in vehicle-treated retinal microglia, pericytes, RASTs, and RECs (N ¼ 4 7, *P 0.05). Messenger RNA was extracted by using RNeasy Plus Mini Kit (Qiagen). The cdna was synthesized by using Sprint RT Complete-Double PrePrimed (Clontech, Mountain View, CA, USA). Cytokine mrnas were measured by quantitative PCR (Eppendorf, Hauppauge, NY, USA) and normalized to the housekeeping gene RpL13A by generating a DCt value. Primer sequences can be found in the following references or Table 2. 18,24 Fold values were generated by normalizing to the vehicle control. Vehicle control samples were used to assay for baseline levels of b-ar. Enzyme-Linked Immunosorbent Assay Laser-induced CNV experiments were performed as described above. Four female mice per group were killed and eyes were harvested at days 3 or 5 post laser treatments. Eyes were combined from each animal to maximize protein yield. Whole eye tissue was homogenized and solubilized in ice-cold PBS buffer containing protease inhibitor (catalog No ; Roche Biochemicals, Mannheim, Germany). The collected samples at day 3 post laser treatment were assayed for IL-6 protein by using mouse IL-6 ELISA kit (R&D Systems). Samples from day 5 post laser treatment were used for VEGF measurements with the mouse VEGF ELISA kit (R&D Systems). Statistical Analysis For CNV, gene expression comparisons between cell lines, and ELISA, Student s unpaired t-test was performed. For cell TABLE 2. Quantitative PCR Primers Species Primer Forward Reverse Mouse IFN-c CATCTTGGCTTTGCAGCTCTT ACTGTGCCGTGGCAGTAACA Mouse RANTES GCCCACGTCAAGGAGTATTTCT CAAACACGACTGCAAGATTGGA Mouse MIP-1b CAGCACCAATGGGCTCTGA GCCGGGAGGTGTAAGAGAAAC Mouse IL-6 CAACCACGGCCTTCCCTACT TTGGGAGTGGTATCCTCTGTGA Mouse IL-8 AAGAGCTACGATGTCTGTGTATTC GGGACTGCTATCACTTCCTTTC Mouse MMP-2 CCGGCCACATCTGGCGTCTG ACGGGGTCCCACGTCCCAAT Mouse MMP-9 CGGCACGCCTTGGTGTAGCA AGGCAGAGTAGGAGCGGCCC Human RpL13A TCTGGACCGTCTCAAGGTGTTTGA TTCTTGTAGGCTTCAGACGCACGA Human VEGF TTTCTGCTGTCTTGGGTGCATTGG ACCACTTCGTGATGATTCTGCCCT Human IL-6 AAAGAGGCACTGGCAGAAA CAGGCAAGTCTCCTCATTGAA b2-adrenergic Receptor and Exudative AMD IOVS j January 2017 j Vol. 58 j No. 1 j 302 FIGURE 3. b2 Adrenergic receptor signaling upregulates VEGF expression in retinal microglia and pericytes. (A B) Mouse retinal microglia and pericytes were preincubated with 1 lm propranolol for 30 minutes followed by incubation with vehicle (veh) or 10 lm NE for 2 hours (N ¼ 4 5, *P 0.05, ***P versus vehicle, #P 0.05, ###P versus NE and vehicle). (C D) Mouse retinal microglia and pericytes were preincubated with 1 lm b1 or 100 nm b2 and b3 antagonists for 30 minutes before 2-hour incubation with vehicle or 10 lmne(n¼4 5, *P 0.05, ***P versus vehicle, #P 0.05, ###P versus NE). (E F) Microglia and pericytes were incubated with 100 nm b1 and b2 or1lm b3 agonists for 2 hours (N ¼ 4 5, *P 0.05, ***P compared to vehicle). culture, each biological N was generated by an experiment on a unique passage day. Thus, Student s paired t-test (two-tailed) was performed to compare two groups. For multiple comparisons, repeated-measures ANOVA was performed and posttests were done by using Bonferroni s correction for multiple comparisons. RESULTS We have previously reported that daily intraperitoneal propranolol treatment reduces CNV area in the laser-induced mouse model. 18 Using mouse RPE and choroidal endothelial cells (ChECs), we then demonstrated that both propranolol and specific b2-ar antagonism inhibit NE-induced VEGF expression in these cells. 18 Our first aim of this study was to extend these results in vivo, showing that b2-blockade can inhibit CNV. For this study, we used a single intravitreal injection of the specific b2-ar antagonist ICI-118,551 at a dose of 0.03 lg per eye. This dose was chosen because we have previously demonstrated that a single intravitreal dose of propranolol at 0.3 lg per eye (0.03 mg/ml) could inhibit CNV in mice and is nontoxic in rabbits. 25 In an initial pilot study, we performed a dose-escalation series by using lg, 0.03 lg, and 0.3 lg ICI-118,551 per eye (not shown). We found that 0.03 lg per eye inhibited CNV formation. We then repeated b2-adrenergic Receptor and Exudative AMD IOVS j January 2017 j Vol. 58 j No. 1 j 303 FIGURE 4. b2 Adrenergic receptor activation stimulates IL-6 expression. (A) Mouse retinal microglia were incubated with vehicle or 10 lm NE for 2 hours and cytokine expression was measured by quantitative real time PCR (qpcr) (N ¼ 3 4, **P 0.01). Interferon-c (IFN-c); tumor necrosis factora (TNF-a); interleukin-1b (IL-1b); IL-6; monocyte chemoattractant protein 1 (MCP-1); macrophage inflammatory protein-1b (MIP-1b); RANTES; matrix metalloproteinase 2 (MMP-2); interleukin-8 (IL-8); matrix metalloproteinase 9 (MMP-9). (B C) Microglia were preincubated with b-ar antagonists as described in Figures 3C and 3D (N ¼ 4, **P 0.01 compared to vehicle, #P 0.05, ##P 0.01 versus NE). this study and found that 0.03 lg ICI-118,551 inhibited CNV formation by 35% (Fig. 1). Retinal endothelial cells, 26 pericytes, 27 microglia, 28 Müller cells, 29 and astrocytes 29 are all sources of VEGF expression. In diabetic retinopathy, pericyte loss is the hallmark of early disease, 30 Müller cells are key pathologic sources of VEGF expression, 31 and microglia are important in the pathologic progression of diabetic eye disease. 32,33 Therefore, we investigated the role of b-ar stimulation and VEGF expression in mouse retinal endothelial cells (RECs), retinal pericytes, retinal microglia, and retinal astrocytes (RASTs). The RASTs used in this study have characteristics of both astrocytes and Müller cells. 21 We found that NE increased Vegf mrna expression by 4.5- and 3.0-fold in retinal microglia and pericytes, respectively (Fig. 2A). Alternatively, NE had no effect on Vegf mrna expression in RECs and RASTs (Fig. 2A). All four types of mouse retinal cells expressed all three b-ar types (Figs. 2B D). To determine which b-ar drives Vegf expression in retinal microglia and pericytes, we pretreated retinal microglia and pericytes with propranolol before NE stimulation. Propranolol completely blocked NE-stimulated Vegf expression in both cell types (Figs. 3A, 3B). Next, retinal microglia and pericytes were pretreated with specific b-ar antagonists before NE administration. The b1-ar antagonist had no effect on NE-driven Vegf expression (Figs. 3C, 3D). Alternatively, the b2- and b3-ar blockers reduced Vegf expression, compared to NE, although more completely in the presence of the b2-ar antagonist (Figs. 3C, 3D). To confirm this result, retinal microglia and pericytes were incubated with b-ar specific agonists. Only the b2-ar agonist significantly increased Vegf expression, compared to vehicle, while the b3-ar agonist demonstrated only a trend in both cell types (Figs. 3E, 3F). In summary, the b2-ar predominantly regulated Vegf expression in retinal microglia and pericytes, with modest effects from the b3-ar. Since the laser-induced CNV model is a highly inflammatory process, we investigated the cytokine profile in retinal microglial cells incubated with NE. We found that after 2 hours of NE treatment, only Interleukin-6 (Il-6) mrna was increased by 7-fold in microglial cells (Fig. 4A). To determine the b-ar responsible for NE-driven Il-6 expression, we pretreated retinal microglial cells with propranolol before NE stimulation. Propranolol significantly decreased NE-driven Il-6 expression (Fig. 4B). Next, we pretreated retinal microglial cells with b-ar specific antagonists. The b2-ar blocker significantly reduced NE-stimulated Il-6 expression (Fig. 4C). In cancer and endothelial cells, b-ar activation increases VEGF and IL-6 expression Therefore, we hypothesized that the b2-ar also regulates IL-6 expression in ChECs, RPE cells, and pericytes. We tested this hypothesis by repeating the above experiments with propranolol, specific b-ar antagonists, and specific b-ar agonists. In the presence of propranolol, NE-stimulated Il-6 expression was completely blocked in ChECs, RPE cells, and pericytes (Figs. 5A, 5D, 5G). After b2-adrenergic Receptor and Exudative AMD IOVS j January 2017 j Vol. 58 j No. 1 j 304 FIGURE 5. b2-adrenergic receptor signaling activates IL-6 expression in ChECs, RPE cells, and retinal pericytes. (A, D, G) Choroidal endothelial cells, RPE cells, and retinal pericytes were preincubated with propranolol identically to Figures 3A and 3B (N ¼ 4 5). (B, E, H) Choroidal endothelial cells, RPE cells, and retinal pericytes were preincubated with b-ar antagonists identically to Figures 3C and 3D (N ¼ 4 6). (C,
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks