Defense gene expression induced by a coffee-leaf extract formulation in tomato

Please download to get full document.

View again

of 9
11 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Defense gene expression induced by a coffee-leaf extract formulation in tomato
Document Share
Document Transcript
  Defense gene expression induced by a coffee-leaf extract formulation in tomato F.C.L. Medeiros a , M.L.V. Resende a , F.H.V. Medeiros a , H.M. Zhang b , P.W. Paré b , * a Departamento de Fitopatologia, Universidade Federal de Lavras, CP 3037, CEP 37200-000, Lavras, Minas Gerais, Brazil b Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409, USA a r t i c l e i n f o  Article history: Accepted 18 November 2009 Keywords:Solanum lycopersicum Systemic acquired resistanceNatural formulationMicroarray analysis a b s t r a c t Plant extracts have the potential to activate defense-related genes with microarray technology aneffective means to probe the mechanism of action. A coffee-leaf extract formulation (NEFID) is shown tobe effective in controlling bacterial spot caused by  Xanthomonas vesicatoria  in tomato ( Solanum lyco- persicum ). Transcriptional changes in tomato leaves elicited with NEFID were evaluated by usinga tomato gene chip. A total of 268 genes were found to be differentially regulated with a majority up-regulated and encoding signal transduction, defense responses, and transcription factors. Chitinases,glucanases and peroxidases (PR-4), with reported activity against pathogens, were transcriptionally up-regulated and corresponding enzyme activities were over-expressed as early as 24 h post elicitation andremained elevated for up to  󿬁 ve days after NEFID exposure. Since salicylic- and jasmonic-acid signalingcomponents were not differentially transcribed with elicitor treatment while mitogen-activated proteins(MAP3K and MAPKK) as well as calcium dependent (calmodulin and phosphatidylinositol) signalingcomponents were up-regulated, a SA/JA-independent transduction sequence for PR accumulation ispostulated. These results demonstrate the ability of the coffee-leaf extract NEFID to differentially regulategene expression in tomato.   2009 Elsevier Ltd. All rights reserved. 1. Introduction Tomato ( Solanum lycopersicum  L., previously  Lycopersicon escu-lentum  Miller) is among the most economically important cropsworldwide [33]. Several characteristics make tomato well suited asa model plant including: a short generation time, easily trans-formed, rich genomic information available, and a diploid genome[2]. The crop is susceptible to over 200 pathogens [17] and signif- icant efforts have directed toward tomato disease control includingbacterial spot caused by  Xanthomonas vesicatoria  [40].Bacterial spot control requires the use of both agrochemicalsand plant resistance. Although the main agrochemicals strepto-mycin sulfate and copper-based products have proven to beef  󿬁 cacious,due toheavyuse, bacterial resistant has developed [13].From a recent breeding program, a tomato cultivar has beenselected with resistance to a wide range of tomato pathogensalthough this line is yet to be commercially available [10].Alternatively, disease control may be achieved by the elicitationof plant resistance genes prior to pathogen attack. Several productshave shown elicitation activity such as the salicylic acid analogueacibenzolar- S  -methyl (ASM). When tomato plants are  󿬁 eld sprayedwith ASM where bacterial spot occurs, an increase of over 100% infruit yield can be observed which is comparable to standardbactericide applications [20].Elicitors based on inactivated pathogens [8] or a combination of inactivated pathogen and plant oligomers have also proved effec-tive in reducing pathogen damage. In addition a preparation basedon rust infected coffee-leaf extracts (NEFID) containing both plantand pathogen elicitors has proven effective for the control of coffeerust and phloem spot, as well as bacterial blight in cotton andpowderymildewin Eucalyptus [29,30].Increasedleafaccumulationof pathogenesis-related proteins, phytoalexins and lignin may atleast in part explain increased plant protection against pathogenswith foliar sprays of NEFID in plants [1,15,31].Transcript analysis has been effectively employed to probedefense responses induced by elicitors including yeast activatedtomato genes encoding SAR-dependent PRs (chitinase and gluca-nase), cytochrome P450s and cell wall loosening enzymes (e.g.expansin, xyloglucan endoglycosl transferase, polygalacturonase)[16,26].In  Arabidopsis transcriptionalanalysishasidenti 󿬁 edelicitorinducedacclimatoryresponsestostress,suchasrecoveryof thecellredox balance (glutathione transferase, UDP glycosyltransferaseand glutaredoxins), intracellular stress signaling, and improvedpathogen recognition [4]. While activation of defense responses by plant elicitors can protect against pathogens, an inhibition of the *  Correspondence to: P.W. Paré, Department of Chemistry, Texas Tech University,1 Chemistry Drive, Lubbock, TX 79409, USA. Tel.: þ 1806 742 3062; fax: þ 1806 7421289. E-mail address:  Paul.Pare@ttu.edu (P.W. Paré). Contents lists available at ScienceDirect Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp ARTICLE IN PRESS 0885-5765/$  e  see front matter    2009 Elsevier Ltd. All rights reserved.doi:10.1016/j.pmpp.2009.11.004 Physiological and Molecular Plant Pathology xxx (2010) 1 e 9 Please cite this article in press as: Medeiros FCL, et al., Defense gene expression induced by a coffee-leaf extract formulation in tomato,Physiological and Molecular Plant Pathology (2010), doi:10.1016/j.pmpp.2009.11.004  biosynthesis of photosynthetic pigments and photosyntheticactivity reducing plant productivity can also occur [12].In order to provide new tools for tomato disease management,our work aims to identify the mechanism of action of the plantextract NEFID that allows for effective tomato disease controlagainst bacterial spot by monitoring transcriptional changes ingene expression with NEFID application. 2. Material and methods  2.1. Plant material and NEFID formulation Tomato seeds ( S. lycopersicum  var. Santa Cruz Kada), purchasedfrom Isla Sementes Ltda (Porto Alegre, Rio Grande do Sul, Brazil)were surface sterilized in 1% (v/v) ethanol for 3 min, followed bya 1.0 g/L sodium hypochlorite solution for 1 min and then rinsedthoroughly with distilled water. Seeds were sown in 1.5 L potscontaining400gofthepottingmixSunshine  All-PurposePlantingMix (Sun Gro Horticulture, Vancouver, CA), fertilized with 5 g of Osmocote fertilizer (Scotts-Sierra Horticulture, Marysville, OH,USA), and irrigated to  󿬁 eld capacity daily. Plants were grown undera controlled temperature (25   C    4), relative humidity 40    10%and light (200  m mol m  2 s  1 ) by using a combination of metalhalide and high sodium pressure lamps set for 14 h/day lightperiod.The coffee formulation (NEFID) contains  󿬁 eld-collected coffeeleaves ( Coffea arabica ), from soil surface (due to disease, harvestfruit and/or other stresses) and selected for powder production. Ahundred grams of this powder is mixed with 1000 mL distilledwater, boiled in re 󿬂 ux and  󿬁 ltered through a sieve of 400 meshes.The  󿬁 ltrate of leaves is sampled and stored at   20   C until use.Twenty- 󿬁 ve days after planting, (plant height  ca . 20    4 cm),tomato leaves are sprayed with NEFID or H 2 O (control).  2.2. Plant inoculation and disease assessment  Bacterial cultures of   X. vesicatoria  strain 89-T from the NationalCenter of Horticultural Research (EMBRAPA, Jagariuna, SP; Brazil)culturecollectionwerecultivatedat28  CinaculturemediaKado&Heskett 523. Inoculumwas obtained frombacterial cells during thelog-phase growth period, cultured in a liquid Kado & Heskett 523medium and incubated under shaking at 200 rpm at 28   C for 12 h(dark). The bacterial cells were concentrated by centrifugation(twice each at 3000 g, 5 min) and resuspended in sterile distilledwater.Inoculumconcentrationwasadjustedbydilutionwithsteriledistilled water to give an absorbance of 0.200 at 540 nm, corre-sponding to 10 11 cfu L   1 . For long-term storage, bacterial cultureswere maintained at   80   C in liquid Kado & Heskett 523 mediumthat contained 20% (v/v) glycerol.Tomato plants were grown similar to the mentioned aboveand at 25 days after sowing (DAS) when they were 20  4 cm tall,they were sprayed until runoff with the NEFID formulation,acibenzolar- S  -methyl (Bion  500 WG, Syngenta Proteção de Culti-vos Ltda, Sao Paulo, Brazil) at 0.2 g/L or water.Threedays after treatment, bacterial inoculationwas performedbyspraying 80 mLof   X. vesicatoria cellsuspension (10 11 cfu per L   1 )until runoff. Disease symptoms were evaluated 45 DAS. Theseverityofbacterial spotwasassessedbyvisualdiagrammaticscalerating of lesions on a 1 e 50% (the percentage of lesions present onthe total leaf area) [42]. Data was submitted to variance analysisand means compared according to Tukey's test (  p  0.05).  2.3. Plant sampling and RNA extraction Plant tissue was harvested and frozen in liquid nitrogen andstored at   80   C for RNA extraction. Samples were ground inmortar and pestle under liquid nitrogen and RNA extractedfollowing the protocol of RNeasy Plant Mini Kit (Qiagen, Valencia,CA, USA) including the RNase-free DNAse treatment step from thesame manufacturer. The clean RNA was quanti 󿬁 ed and stored at  80   C.  2.4. Microarray analysis Microarrayhybridizationsconsistedoffourbiologicalreplicates,one of which consisted of a dye swapping. The previously obtainedtarget RNA was transcribed to aRNA in a three step transcriptionusing Amino-Allyl aRNA Ampli 󿬁 cation Kit (Ambion, Austin, TX,USA) and labeled with NHS dyes Cy3 or Cy5 (Amersham Biosci-ences, Little Chalfont Buckinghamshire, UK) according to themanufacturer's protocol. Samples were assayed on the tomatoTOM2 oligo-arrays printed at University of Arizona. Each chipcontaining 12,160 70-mer oligonucleotide elements (http://ted.bti.cornell.edu/cgi-bin/TFGD/array).Slide pre-hybridization was performed according to the manu-facturer, whereas hybridization and post-hybridization followedthe  Arabidopsis thaliana  protocol [41]. The arrays were scannedusing a GenePix 4100 array scanner (Axon Instruments, Sunnyvale,CA, USA). Spot statistical analysis was performed according to themanufacturer's guidelines (Gene-Spring 7.0; Silicon Genetics,Redwood, CA, USA). A 40% change, either up- or down-regulation,in the expression level compared with the control was selected asthe threshold for a gene to be classi 󿬁 ed as altered in response toNEFID treatment. Only genes that passed the  󿬂 ag  󿬁 ltering, identi- 󿬁 ed as present (Gene-Spring 7.0), and passed the  t  -test  p -values0.10 was considered differentially regulated with the NEFIDtreatment.  2.5. Microarray validation For the microarray result validation,  󿬁 rst strand cDNA wassynthesized from 5  m g of total RNA following Zhang et al. [41] andPCR performed using the (5 0 e 3 0 ) primers designed based on geneswith signi 󿬁 cantly changed expression (Table 1). Seven genes were  Table 1 Primers used for RT-PCR.Gene Name Forward ReverseEndo-1,3-beta-glucanase SGN-U212943 ACAGCTCATACATGGCCTTCT ATTGGGCTTCTTGGTTGTGGTTGGPectinesterase SGN-U214672 CGCATGGGCTGATTGCATTGAACT CGACGACCGACGATGCAACAATTTChitinase SGN-U224778 ATGGCGGAAACTGTCCTAGTGGAA ACATGGTCTACCATCAGCTTGCCACalmodulin SGN-U212854 TGCTGGTAGTTGTGGGAGTTGAGA AGCTCCTTAGTCGTGATGCAACCTPeroxidase SGN-U213351 ACGGAGCAAGCGACAATTGACAAC CGATTGATTCACCGCAAAGCTCGTProteinase inhibitor SGN-U213363 CGGAGAATCTGAATGGGTAAGCGA ACAAGCCGTGGTAAAGGTCCACAAGlutathione- S  -transferase SGN-U216884 TGTCCCAACCTTCTCGTGCAGTTA TGAGTGATGCCAGTCCAACACAGAActin SGN-U226051 TTGACTGAGGCACCACTTAACCCT GCTTTCAGGTGGTGCAACGACTTT F.C.L. Medeiros et al. / Physiological and Molecular Plant Pathology xxx (2010) 1 e 9 2 ARTICLE IN PRESS Please cite this article in press as: Medeiros FCL, et al., Defense gene expression induced by a coffee-leaf extract formulation in tomato,Physiological and Molecular Plant Pathology (2010), doi:10.1016/j.pmpp.2009.11.004  chosen (Table 1) and the primers designed based on the UNIGENEused to generate each microarray probe (Tomato functional geno-mics database, available at http://ted.bti.cornell.edu/). Agarose gelelectrophoresis images were taken byKodak Gel Logic 100 ImagingSystem (Fisher Scienti 󿬁 c, Houston, TX, USA) and the band intensityquanti 󿬁 ed by Image J 1.33u (http://rsb.info.nih.gov/ij/, NationalInstitute of Health, USA).  2.6. Enzyme extraction, PR protein, defense enzyme assay Leaf (1.0 g), treated with the natural formulation (NEFID) orwater (control), were harvested at 0, 24, 48, 72, 96 and 120 hoursafter spraying (HAS), was homogenized for 5 min in a mortar witha pestle in 3 mL of ice-cold 50 mM sodium acetate buffer pH 5.2,containing 0.1 mM EDTA. After  󿬁 ltration, the homogenate wascentrifuged at 13,000 g for 15 min and the supernatant (crudeextract) used as the source of enzymes. All the steps were carriedout at 0 e 4   C [8]. Protein content of the crude extracts was deter-mined using a Bradford [5] protein assay, with bovine serumalbumin (BSA) as a standard.The activity of guaiacol peroxidase POX (EC 1.11.1.7) was deter-mined byadding 25 mL of the crude-extract preparation to 2 mL of a solution containing 50 mM sodium acetate buffer, pH 5.2, 20 mMguaiacol and 20 mM hydrogen peroxide. After incubation at 30   Cfor10min,theabsorbancewasreadat480nm[36].OnePOXunitof activity (UA) was expressed as the variation of one unit of absor-bance at 480 nm per milligram of soluble protein per minute(UA mg P  1 min  1 ).Chitinase activity CHI (PR-3; EC 3.2.1.14) was determined byadding 70  m L of a suitable diluted crude extract with 130  m L of 50 mM sodium acetate pH 5.2 and 60  m L of CM-Chitin-RBV (2 mg mL   1 ), a polymeric carboxymethyl-substituted chitin,labeled covalently with Remazol Brilliant Violet 5R (CM-Chitin-RBV, Loewe Biochemica, Germany) used as substrate, in micro-plates of 96 wells with a capacity of 350  m L. After incubation at35   C for 80 min, samples were acidi 󿬁 ed with 50  m L of 0.5 N HCl,cooled in ice bath for 10 min and centrifuged (1450 g for 10 min).Absorbance of the supernatant at 492 nm was recorded and theresults were expressed as UA. One unit of CHI activity was de 󿬁 nedas the variation of one absorbance unit at 492 nm per milligram of soluble proteinper minute (UA mg P  1 min  1 ). Assays werecarriedout in triplicate.The activity of beta-1,3-glucanase GLU (PR-2; EC 3.2.1.39) wasmeasuredusingsimilarmethod,withtheexchangeof thesubstratefor CM-Curdlan-RBB (4 mg mL   1 ) and the adjustment of the rate of enzyme extract to 100  m L (minus the volume of acetate buffer inordertoadjustthe 󿬁 nalvolumeto310  m Lpercavity).Anincubationperiod of 35   C for 100 min was adopted to promote the hydrolyticaction of beta-1,3-glucanase. Absorbance of the supernatant at620 nm was recorded and the results were expressed as UA. Oneunit of CHI activity was de 󿬁 ned as the variation of one absorbanceunit at 620 nm per milligram of soluble protein per minute(UA mg P  1 min  1 ). Assays were carried out in triplicate.  2.7. Experimental design and statistical methods For the biochemical determinations, experiments werearranged in randomized block designs, with three blocks, oneexperimental unit (plot) consisted of four 3 L pot containing threeplants each. For analysis by microarray and reverse transcriptionpolymerase chain reaction (RT-PCR) experiments, plants werearranged in randomized blocks designs, with three blocks, and oneexperimental unit (plot) consisted of four 1.5 L pot containing twoplants each. Variance analysis was run using SAS (Statistical Anal-ysis Systems Inc., Cary, NC, USA) statistical software. Means wereseparated using Tukey's test at  p  value less than 0.05 using Sisvar,a statistical tool purchased from the Federal University of Lavras,Minas Gerais, Brazil. 3. Results  3.1. Plant extract sprays protect plants against bacterial spot  Both NEFID and acibenzolar- S  -methyl (Bion) confer tomatoleaves protection against bacterial spot caused by  X. vesicatoria  byreducing the disease severity by 65 and 69%, respectively. DiseaseseverityforplantssprayedwithNEFIDorBionwerenotstatisticallydifferent (  p  0.05) at the time point evaluated (Fig.1).  3.2. Regulation of gene expression by NEFID In order to provide insight into underlying mechanismsresponsible for the induction of resistance bya natural formulationbased on a coffee-leaf extract, genome-wide analysis of geneexpression was performed using oligonucleotide microarray anal-ysis. Three independent experiments were performed in whichlabeledmRNAfromtomatoleaftissueharvestedat12haftercoffee-leafextract (NEFID) orwaterleafspraying.cDNA preparations werehybridized to oligonucleotide tomato microarray slides (TOM2)containing 12,000 spots, designed for over 11,000 unique tomatogenes. In response to NEFID treatment a total of 268 genes weredifferentially expressed compared to the water control (Table 2).A large majority ( > 80%) were up-regulated with 215 and 53 up anddown regulated, respectively. Microarray responses were validatedby RT-PCR analysis with all of the assayed genes showing a similarfold change (Fig. 2).Based on annotated gene assignments, genes differentiallyregulated by NEFID elicitation are categorized by functionaccording to the following groups: signal transduction (9% of up-regulated genes, 2% of down-regulated genes), transcript factors(8% of up-regulated genes, 11% of down-regulated genes), oxida-tive burst/hypersensitive response (7% of up-regulated genes),defense response (6% of up-regulated genes, 4% of down-regulatedgenes), energy pathways (6% of up-regulated genes, 4% of down-regulated genes), protein biosynthesis (5% of up-regulated genes,2% of down-regulated genes), protein degradation (4% of up-regulated genes), cell wall metabolism (4% of up-regulated genes,4% of down-regulated genes), cell structure (2% of up-regulatedgenes, 5% of down-regulated genes), general metabolism (2% of  010203040506070 treatments    d   i  s  e  a  s  e  s  e  v  e  r   i   t  y   (   %   ) NEFIDBIONCONTROL aab Fig. 1.  Tomato disease severity (45 days after sowing) with leaves sprayed at 20 DASwith a coffee-leaf extract (NEFID), acibenzolar- S  -methyl (Bion) or water (control) andthree days subsequently infected with the tomato pathogen  Xanthomonas vesicatoria that causes bacterial spots on leaves. Bars headed with the same letter are statisticallysimilar according to Tukey's test (  p  <  0.05). F.C.L. Medeiros et al. / Physiological and Molecular Plant Pathology xxx (2010) 1 e 9  3 ARTICLE IN PRESS Please cite this article in press as: Medeiros FCL, et al., Defense gene expression induced by a coffee-leaf extract formulation in tomato,Physiological and Molecular Plant Pathology (2010), doi:10.1016/j.pmpp.2009.11.004   Table 2 Classi 󿬁 cation of gene differentially expressed in tomato ( Solanum lycopersicum ) 12-h after NEFID treatment.Gene classes Gene number Response Ratio (treated/control)Up-regulated ¼ 215 genes  80% of regulated genes totalSIGNAL TRANSDUCTION20 Calcium-dependent protein kinase, calmodulin-binding protein, transducin/WD-40 repeat protein,calmodulin, protein kinase, phototropic response protein, phosphatidylinositol-4-phosphate 5-kinase,MAP3K-like protein kinase, mitogen-activated protein kinase kinase (MAPKK), leucine rich repeatprotein family contains protein kinase domain, receptor-related serine/threonine kinase, proteinphosphatase 2C (PP2C), tyrosine phosphatase, calcineurin-like phosphoesterase, F-box protein familysimilar to SKP1 interacting partner 2 (SKIP2), transmembrane protein1.5 e 2.4TRANSCRIPTIONFACTOR 17 HD-ZiptranscriptionfactorAthb-13,bZipDNAbindingprotein,homeobox-leucinezipperproteinHAT5,DHHC-type zinc  󿬁 nger domain, transcription factor L2, MADS-box family protein, homeobox-leucinezipper protein ATHB-13, MADS-box protein 9, MYB family transcription factor, transcription factor SF3,transcriptional factor B3 family protein/auxin-responsive factor, GT-1-related transcription factor,transcriptional adaptor like protein, homeodomain protein contains  ‘ Homeobox ’  domain signature1.4 e 2.6OXIDATIVE BURST/HYPERSENSITIVERESPONSE14 Peroxidase, glutathione peroxidase, copper/zinc superoxide dismutase (CSD2), copper/zincsuperoxidase dismutase (CSD1), glyoxalase II, cytochrome P450, glutathione transferase1.4 e 2.6DEFENSE RESPONSE 13 Pathogenesis-related protein 1 precursor (PR-1), endo-1,3-beta-glucanase-like protein, basicendochitinase, hevein-related protein precursor (PR-4), pathogenesis-related protein, glycosylhydrolasefamily19(basicendochitinase),diseaseresistanceprotein(NBS-LRRclass),leucinerichrepeatprotein, (PDF2.3) plant defensin protein, disease resistance protein, VIP2 protein, TSW12, Ethylene-responsive proteinase inhibitor I precursor1.5 e 2.9ENERGY PATHWAYS 12 Pyruvate, orthophosphate dikinase, lycopene beta cyclase, malate oxidoreductase (NADP-dependentmalic enzyme), gamma-VPE (vacuolar processing enzyme), GCN5-related N-acetyltransferase (GNAT),short-chain dehydrogenase/reductase, mitochondrial aldehyde dehydrogenase (ALDH3), GDP-mannosepyrophosphorylase, L-allo-threonine aldolase, epsilon subunit of mitochondrial F1-ATPase, cytochromeb561-related, cytochrome b5 domain-containing protein1.5 e 2.3PROTEINBIOSYNTHESIS11 Ubiquitin family, deoxyhypusine synthase, cytosolic cyclophilin (ROC3), cyclophilin ROC7, 40Sribosomal proteinS14(RPS14B),60SribosomalproteinL10A(RPL10aB),60Sacidicribosomal proteinP0(RPP0B), symbiosis-related like protein, RHO GDP-dissociation inhibitor 1-related, eukaryotic rpb5 RNApolymerase subunit, eukaryotic translation initiation factor 4A-1 (eIF4A-1)1.4 e 1.8PROTEINDEGRADATION9 Serine carboxypeptidase, serine carboxypeptidase III, Ethylene-responsive proteinase inhibitor Iprecursor, proteasome regulatory particle triple-A ATPase subunit4, ubiquitin-conjugating enzyme 2(UBC2) E2, ubiquitin-associated (UBA)/PB1, ubiquitin-conjugating enzyme 10 (UBC10) E21.5 e 2.4CELL WALL 8 Endo-1,4-beta-glucanase, cellulase, xyloglucan endotransglycosylase, glycosyltransferase family 8,xyloglucan endo-1,4-beta- D -glucanase (EC 3.2.1.-) precursor, alpha-expansin 6 precursor, Alpha 1,4-glycosyltransferase, O-diphenol-O-methyl transferase,1.4 e 2.2G PROTEIN 5 GTPase-activating protein, ARF GTPase-activating domain, GTP-binding protein, Ras-related GTP-binding protein (ARA-4), putative ATP(GTP)-binding protein1.5 e 1.9TRANSPORT 5 ATPase plasma membrane-type (proton pump), H þ -transporting ATP synthase-related protein, SNF7protein, putative UDP-galactose transporter, transporter e related low similarity to hexose transporter1.5 e 1.9CELL STRUCTURE 5 Histone H2A, pro 󿬁 lin 5, actin polymerisation complex protein, actin-related protein 8B (ARP8) protein 1.5 e 1.7NUCLEIC ACIDMETABOLISM5 Macrophage migration inhibitory factor (MIF), RNA-binding protein, endonuclease/exonuclease/phosphatase family, ADP-ribosylation factor, RNA recognition motif (RRM)1.4 e 2.0HORMONE RESPONSE 4 Auxin-responsive protein, ethylene-response protein ETR1, arginine decarboxylase, 2-oxoglutarate-dependent dioxygenase1.5 e 2.6METABOLISM 4 Glutamate decarboxylase (EC 4.1.1.15) 2, starch synthase, phosphomannomutase-related, phytoenesynthetase1.7 e 2.0LIPID METABOLISM 4 Lipase (class 3) family, ceramidase family protein, myo-inositol-1-phosphate synthase-related protein,thioesterase family1.6 e 1.8STRESS RESPONSE 4 Heat shock protein, Pi starvation-induced protein, metallothionein 2b, DnaJ protein 1.4 e 1.8PHOTOSYNTHESIS 3 Thioredoxin M-type 4, chloroplast precursor (TRX-M4), glutathione synthetase (GSH2), chloroplastnucleoid DNA binding protein1.5 e 1.8DETOXIFICATION 2 Rhodanese-like domain protein 1.5 e 2.1OTHER 20 Steroid sulfotransferase, aldehyde oxidase, 12-oxophytodienoate reductase (OPR3), pescadillo  e  likeprotein, oxidoreductase, 2OG-Fe(II) oxygenase, nitrilase 1 like protein, hydrolase alpha/beta fold family,putative spermine/spermidine synthase, heme oxygenase 1 (HO1) gene, COP9 complex subunit, FUS4FUSCA4, COP8, CSN4, acyltransferase family,  󿬁 brillarin 2, oxidoreductase (din11), glutaredoxin protein,iron-sulfur cluster assembly complex protein, hypothetical protein, copper amine oxidase -related,glutaredoxin protein, aldo/keto reductase family, nodulin MtN3 family1.4 e 2.9UNKNOWN 50  e  1.4 e 3.8Down-regulated ¼ 53 genes  20% of regulated genes totalCELL STRUCTURE 3 Histone H3, histone H2B, histone H1 0.6 e 1.6CELL WALL 2 Pectinesterase, N-acetylglucosaminyltransferase 0.4 e 0.5 F.C.L. Medeiros et al. / Physiological and Molecular Plant Pathology xxx (2010) 1 e 9 4 ARTICLE IN PRESS Please cite this article in press as: Medeiros FCL, et al., Defense gene expression induced by a coffee-leaf extract formulation in tomato,Physiological and Molecular Plant Pathology (2010), doi:10.1016/j.pmpp.2009.11.004  up-regulated genes, 2% of down-regulated genes), hormoneresponse (2% of up-regulated genes, 4% of down-regulated genes),transport (2% of up-regulated genes, 2% of down-regulated genes),lipid metabolism (2% of up-regulated genes, 4% of down-regulatedgenes), photosynthesis (1% of up-regulated genes, 19% of down-regulated genes), nucleic acid metabolism (2% of up-regulatedgenes), G protein (2% of up-regulated genes), stress response (2% of up-regulated genes), detoxi 󿬁 cation (1% of up-regulated genes),proteinase inhibitor (13% of down-regulated genes), and others (9%of up-regulated genes,11% of down-regulated genes). A remainingcategory is un-annotated genes referred to as unknown (23% of up-regulated genes, 13% of down-regulated genes); the fraction of each gene group is shown (Fig. 3).The  󿬁 ve categories with the larger number of representatives(except for unclassi 󿬁 ed protein) were the up-regulated signaltransduction (with 7.5% of the total regulated genes), transcriptionfactors (6.3%), oxidative burst/hypersensitive response (5.2%),defense response (4.8%) and energy pathways (4.5%) their counter-parts found to be down-regulated were much less abundant with0.4, 2.2, 0.0, 0.7, 0.7% of the total regulated genes, respectively. Thecategory with the larger number of representatives in the down-regulatedgeneswasthephotosynthesisrelatedgeneswith10genes.  Table 2  ( continued )Gene classes Gene number Response Ratio (treated/control)DEFENSE RESPONSE 1 Terpene synthase/cyclase 0.6HORMONE RESPONSE 2 Ethylene-response protein ETR1, GAST1-related protein induced by gibberellins 0.5 e 0.6METABOLISM 1 Sugar isomerase 0.6PROTEINBIOSYNTHESIS1 Eukaryotic translation initiation factor 3 subunit 10 0.4SIGNAL TRANSDUCTION1 Putative membrane protein 0.5TRANSCRIPTIONFACTOR 6 PHD  󿬁 nger transcription factor, lateral organ boundaries (LOB) domain protein 37, ANAC057;transcription factor, GATA zinc  󿬁 nger protein, WRKY family transcription factor0.4 e 0.6TRANSPORT 1 Peptide transporter e  like protein 0.2ENERGY PATHWAYS 2 Alkaline/neutral invertase, NAD-dependent epimerase/dehydratase 0.5 e 0.5LIPID METABOLISM 2 Lipoic acid synthase, 3-oxoacyl-[acyl-carrier-protein] synthase I precursor 0.4 e 0.6PHOTOSYNTHESIS 10 Ribulose bisphosphate carboxylase small chain 3b precursor, ribulose bisphosphatecarboxylase small chain 2b precursor, plastocyanin, chlorophyll a-b binding protein3C-like, light-harvesting chlorophyll  a / b  binding protein, protochlorophyllide reductase B0.3 e 0.6PROTEINASEINHIBITOR 7 Proteinase inhibitor e  tomato 0.4 e 0.5OTHER 6 Putative membrane-associated salt-inducible protein, hypothetical protein DDBDRAFT_0219654,germin-like protein, Tic62 protein, dopamine beta-monooxygenase, gda-10.3 e 0.6UNKNOWN 7 0.4 e 0.6 Fig. 2.  Expression level of genes of signi 󿬁 cantly changed regulation (  p  < 0.10 and ratio > 1.4 or < 0.6) from the microarray data compared to the RT-PCR: endo-1,3-beta-glucanaseSGN-U212943 (GLU), chitinase SGN-U224778 (CHI), peroxidase SGN-U213351 (POX), glutathione- S  -transferase SGN-U216884 (GST), proteinase inhibitor SGN-U213363 (PIN),calmodulin SGN-U212854 (CAM), pectinesterase SGN-U214672 (PEC), and actin (ACT). F.C.L. Medeiros et al. / Physiological and Molecular Plant Pathology xxx (2010) 1 e 9  5 ARTICLE IN PRESS Please cite this article in press as: Medeiros FCL, et al., Defense gene expression induced by a coffee-leaf extract formulation in tomato,Physiological and Molecular Plant Pathology (2010), doi:10.1016/j.pmpp.2009.11.004
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks