Biological Agriculture & Horticulture: An International Journal for Sustainable Production Systems Exploiting endophytic bacteria for the management of sheath blight disease in rice PLEASE SCROLL DOWN FOR ARTICLE

Please download to get full document.

View again

of 18
6 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Biological Agriculture & Horticulture: An International Journal for Sustainable Production Systems Exploiting endophytic bacteria for the management of sheath blight disease in rice PLEASE SCROLL DOWN FOR ARTICLE
Document Share
Document Transcript
  This article was downloaded by: [Nagendran Krishnan]On: 07 October 2013, At: 19:24Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Biological Agriculture & Horticulture:An International Journal forSustainable Production Systems Publication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/tbah20 Exploiting endophytic bacteria for themanagement of sheath blight disease inrice K. Nagendran a , G. Karthikeyan a , P. Mohammed Faisal a , P.Kalaiselvi a , M. Raveendran b , K. Prabakar a  & T. Raguchander aa  Department of Plant Pathology, Centre for Plant ProtectionStudies, Tamil Nadu Agricultural University, Coimbatore, 641 003,India b  Department of Molecular Biology and Biotechnology, Centrefor Plant Protection Studies, Tamil Nadu Agricultural University,Coimbatore, 641 003, IndiaPublished online: 01 Oct 2013. To cite this article:  K. Nagendran, G. Karthikeyan, P. Mohammed Faisal, P. Kalaiselvi, M.Raveendran, K. Prabakar & T. Raguchander , Biological Agriculture & Horticulture (2013):Exploiting endophytic bacteria for the management of sheath blight disease in rice, BiologicalAgriculture & Horticulture: An International Journal for Sustainable Production Systems, DOI:10.1080/01448765.2013.841099 To link to this article: http://dx.doi.org/10.1080/01448765.2013.841099 PLEASE SCROLL DOWN FOR ARTICLETaylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.  This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions    D  o  w  n   l  o  a   d  e   d   b  y   [   N  a  g  e  n   d  r  a  n   K  r   i  s   h  n  a  n   ]  a   t   1   9  :   2   4   0   7   O  c   t  o   b  e  r   2   0   1   3  Exploiting endophytic bacteria for the management of sheath blightdisease in rice K. Nagendran a *, G. Karthikeyan a , P. Mohammed Faisal a , P. Kalaiselvi a , M. Raveendran b ,K. Prabakar a and T. Raguchander a a  Department of Plant Pathology, Centre for Plant Protection Studies, Tamil Nadu AgriculturalUniversity, Coimbatore 641 003, India;  b  Department of Molecular Biology and Biotechnology,Centre for Plant Protection Studies, Tamil Nadu Agricultural University, Coimbatore 641 003, India (  Received 17 April 2013; accepted 2 September 2013 )Sheath blight of rice caused by  Rhizoctonia solani  Kuhn is an important soil-bornedisease throughout the rice-producing areas of the world. Twenty-nine bacterialendophytes were isolated from different plant sources and tested for their efficacyagainst  R. solani  inciting sheath blight in rice.  Bacillus subtilis  var.  amyloliquefaciens (FZB24) caused a maximum 36% inhibition of   R. solani  over the control  in vitro . Riceplants (cv. ADT 39) treated with FZB24, in combination with seed treatment @4gkg 2 1 , seedling dip @ 4gl 2 1 , soil application @ 500gha 2 1 and foliar application @500gha 2 1 , gave the lowest severity of sheath blight (33%) with around 55% reductionover the control under glasshouse conditions. In addition, the  B. subtilis  (FZB24)treated rice plants showed higher induction of defence-related enzymes, peroxidase,polyphenol oxidase and phenylalanine ammonia lyase, and resulted in higheraccumulation of total phenols than in the untreated control plants. The endophyte-treated rice plots had a significantly lower intensity of sheath blight than untreatedcontrol plots and also recorded a higher grain and straw yield. Keywords:  Bacillus ; endophytes; induced systemic resistance;  Rhizoctonia solani ; ricesheath blight Introduction Sheath blight of rice caused by  Rhizoctonia solani  Kuhn is a major soil-borne diseasethroughout the rice-producing areas of the world and is the most economically importantfungaldisease ofrice (Ou1985).The recent semi-dwarf cultivars are normallygrownmore inareas that create a favourable environment for development and observe outbreak of sheathblight, which is considered one of the most important constraints to high grain yield andquality. No genetic resistance has been reported for this disease, and all rice cultivars aresusceptible.Itcancauseyieldloss ofupto25%(Karthibaetal.2009;Kumaretal.2009).The use of biological control agents as an alternativeto fungicides is increasing rapidly in present-dayagriculture.Recently,focushasbeenontheidentificationofeffectivebioagents,especiallyfluorescent pseudomonadbacterial strains andendophytic  Bacillus  strains,whichhave simplenutritionalrequirements,excellentrootcolonizingabilityandelicitsignalsfortheinductionof defence proteins upon infection by pathogens (Rajendran et al. 2006; Saveetha 2009). Endophytic bacteria are those bacteria that colonize the plant internally without doing itsubstantial harm (Wilson 1995). Bacterial endophytes may have beneficial effects on hostplants,suchasgrowthpromotionandbiologicalcontrol ofpathogens(Downing& Thomson q 2013 Taylor & Francis *Corresponding author. Email: krishnagendra@gmail.com  Biological Agriculture & Horticulture , 2013http://dx.doi.org/10.1080/01448765.2013.841099    D  o  w  n   l  o  a   d  e   d   b  y   [   N  a  g  e  n   d  r  a  n   K  r   i  s   h  n  a  n   ]  a   t   1   9  :   2   4   0   7   O  c   t  o   b  e  r   2   0   1   3  2000; Adhikari et al. 2001), enhanced nitrogen fixation (Boddey & Dobereiner 1988) and increased resistance to pathogens (Hallmann et al. 1997). It has been suggested that bacteriamight interact closely with the host plant and therefore could be efficient biological controlagentsinsustainablecropproduction(Sturzetal.2000).  Bacillus speciesareamongthemostcommonbacteria foundto colonizeplants endophytically(Lilleyetal.1996; Hallmannetal. 1997), and it is likely that their endophytic ability could play a role in the biocontrol of vascular plant pathogens. Rice plants treated with plant growth promoting rhizobacteria(PGPR)consortium(Pf1  þ  AH1  þ  B2)showedhigheractivitiesofdefenceenzymessuchasperoxidase (PO), polyphenol oxidase (PPO), chitinase and lipoxygenase, which in turnconferred resistance against rice sheath blight pathogen (Karthiba et al. 2009).Rangeshwaran et al. (2002) reported that endophytic bacterial isolates play a significantrole in plant protection against soil-borne plant pathogens and in overall productivity of agricultural ecosystems. Endophytic bacteria have been shown to control  Fusariumoxysporum  f. sp . vasinfectum  on cotton (Chen et al. 1995),  F. oxysporum  f. sp . pisi  on pea(Benhamou etal.1996a), Verticillium alboatrum  onpotato(Plebanetal. 1995) and  R.solani on rice (Krishnamoorthy & Gnanamanickam 1997). The mechanisms by which endophytescan act as biocontrol agents include the production of antifungal or antibacterial agents(Maurhofer et al. 1991), siderophore production (Duij et al. 1993), nutrient competition (Kloepper et al. 1980), niche exclusion and, indirectly, through the induction of systemicacquiredhostresistanceorimmunity(Chenetal.1995;Liuetal.1995).Thus,anattempthas beenmadewiththeobjectivestoisolate,screenandcharacterizetheendophytic  Bacillus spp.,to study the biochemical basis for management of sheath blight under glasshouse conditionsand tomanagesheath blightdisease ofriceunder field conditions using endophytic  Bacillus . Materials and methods  Isolation of pathogen Rice sheath blight pathogen  R. solani  was isolated from naturally infected leaf sheathsamples collected from Aduthurai, Tamil Nadu (India), through the tissue segment method(Riker & Riker 1933). The pure culture of the pathogen was obtained by using the singlehyphal tip technique (Inagaki 1998). Pathogenicity of the isolated fungus  R. solani  hasbeen proved on the rice cv. ADT 39, a susceptible and commonly grown cultivar, bymethodology explained by Sriram et al. (1997).  Isolation of endophytes Source plants were manually uprooted and brought to the laboratory. Root, stem and leaf sections (2–3cm long) were cut using a sterile scalpel. The root samples were taken justbelow the soil line for younger plants and 5–10cm below the soil line for older plants.Samples were surface sterilized and washed in four changes of 0.02-M phosphate buffersolution. A measured 0.1-ml aliquot from the final buffer wash was removed andtransferred to 9.9-ml tryptic soya broth to serve as a sterile check. Selected samples weretriturated in 9.9ml of buffer in a sterile pestle and mortar. The triturate was serially dilutedand plated on tryptic soya agar (TSA). Representatives of colony morphology weretransferred to fresh TSA plated as pure cultures (McInroy & Kloepper 1995).  Molecular characterization of endophytes The genomic DNA from all the endophytes was isolated using the standard protocol of cetyl trimethyl ammonium bromide method proposed by Knapp and Chandlee (1996) with2  K. Nagendran  et al.    D  o  w  n   l  o  a   d  e   d   b  y   [   N  a  g  e  n   d  r  a  n   K  r   i  s   h  n  a  n   ]  a   t   1   9  :   2   4   0   7   O  c   t  o   b  e  r   2   0   1   3  slight modifications. To confirm the isolates as  Bacillus  species, 16S rDNA interveningsequence specific BCF 1 (5 0 CGGGAGGCAGCAGTAGGGAAT3 0 ) and BCR2 (5 0 CTC-CCCAGG CGGAGTGCTTAAT3 0 ) primers (Operon, Inc., Alameda, CA) were used toobtain an amplicon of size 546bp (Cano et al. 1994). Amplification was done with a totalreaction volume of 25 m l in an Eppendorf Master Cycler, Hamburg, Germany. Thepolymerase chain reaction(PCR) settings were: a hold of 2min at 95 8 C, 40 cycles of 1minat 95 8 C, 1min at 55 8 C and 1min at 72 8 C and a final extension of 5min at 72 8 C. The PCRproducts were resolved on 2% agarose at 50V stained with ethidium bromide(0.5 m gml 2 1 ) and photographed and analysed using gel documentation system (AlphaInnotech Corporation, San Leandro, CA).  In vitro screening of endophytes Endophytic bacterial strains were evaluated for their antagonistic efficiency against themycelial growth of   R. solani  through the dual-culture technique (Dennis & Webster 1971).Efficiency of the antagonistic endophytes against sheath blight pathogen was determinedbased on their size of inhibition zone.  Efficacy of endophytic Bacillus subtilis var. amyloliquefaciens (FZB24) bioformulation against sheath blight under glasshouse conditions Cornstarch-based formulation of   Bacillus subtilis  (FZB24) with minimum population of 1  £  10 10 cfug 2 1 was delivered as seed treatment, seedling dip, soil application and foliarspray in two different concentrations and also in combinations of treatments. Theformulation contained 13%  B. subtilis  (FZB24) and 87% cornstarch obtained from M/S.Novozymes South Asia Pvt. Ltd, Bangalore, India.  R. solani  was inoculated as explainedby Sriram et al. (1997). Plants treated with iprobenfos (0.1%) as a foliar spray served as thechemical check. Inoculated and uninoculated controls were also maintained separately.Pots were placed in a completely randomized design; three rice seedlings (cv. ADT 39)were planted per pot with three replications of each treatment. The effectiveness of thetreatments on the intensity of sheath blight disease was observed seven days afterinoculation, with a 0–9 scale of the Standard Evaluation System for rice (IRRI 2011), andthe per cent disease indices were calculated. In addition, growth parameters, plant heightand number of tillers were also recorded at different time intervals. Plant samples werecollected at different time intervals from different treatmentsto studythe induced systemicresistance (ISR). Testing the efficacy of endophytes against sheath blight of rice under field conditions Two field trials with rice cv. ADT 39 were laid out in different seasons in a randomizedblockdesignwiththreereplicationsandplotsize4  £  3mwith12treatments.Observationsonpercentincidenceofsheathblightwererecorded90daysaftertransplanting.Thegrowthparameters, plant height and number of tillers were recorded at different time intervals.Grain and straw yield per ha was also recorded. Statistical analysis Statistical analysis of the data was made with 5% level of significance using packageIRRISTAT version 92 of International Rice Research Institute Biometrics Unit, Manila,Philippines. Endophytic bacteria and rice sheath blight   3    D  o  w  n   l  o  a   d  e   d   b  y   [   N  a  g  e  n   d  r  a  n   K  r   i  s   h  n  a  n   ]  a   t   1   9  :   2   4   0   7   O  c   t  o   b  e  r   2   0   1   3
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks