A mitotic kinesin-like protein required for normal karyokinesis, myosin localization to the furrow, and cytokinesis in Dictyostelium

Please download to get full document.

View again

of 6
65 views
PDF
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Document Description
Dictyostelium mitotic kinesin Kif12 is required for cytokinesis. Myosin II localization to the cleavage furrow is severely depressed in Kif12-null (kif12) cells, which accounts in part for the cytokinesis failure. Myosin II-null cells, however,
Document Share
Document Tags
Document Transcript
  A mitotic kinesin-like protein required for normalkaryokinesis, myosin localization to the furrow, andcytokinesis in  Dictyostelium  Gandikota S. Lakshmikanth, Hans M. Warrick, and James A. Spudich* Department of Biochemistry, Stanford University School of Medicine, Stanford, CA 94305Contributed by James A. Spudich, October 4, 2004 Dictyostelium  mitotic kinesin Kif12 is required for cytokinesis.Myosin II localization to the cleavage furrow is severely depressedin Kif12-null (  kif12 ) cells, which accounts in part for the cytoki-nesis failure. Myosin II-null cells, however, undergo mitosis-cou-pled cytokinesis when adhering to a surface, whereas the   kif12 cells cannot. During mitosis, the rate of change of internuclearseparationin  kif12 cellsisreducedcomparedwithwild-typecells,indicatingmultiplerolesofthismolecularmotorduringmitosisandcytokinesis. GFP-Kif12, which rescues wild-type behavior whenexpressed in the   kif12  strain, is concentrated in the nucleus ininterphase cells, translocates to the cytoplasm at the onset ofmitosis, appears in the centrosomes and spindle, and later isconcentrated in the spindle midbody. Given these results, wehypothesize a mechanism for myosin II translocation to the furrowto set up the contractile ring. Kif12    cell-cycle regulation    mitosis C  ytokinesis and karyokinesis are fundamental to cell divisionand propagation. Karyokinesis involves nuclear segregationand requires the formation of a microtubule network on whichthe chromosomes are segregated with the help of kinesin-basedmotors. Cytokinesis involves division of cellular components of a parental cell into two daughter cells, and it is precisely timedalong with nuclear division in almost all cells. Cytokinesis isgenerally achieved by an actin–myosin-based contractile ringthat is assembled along the plane perpendicular to the axis of thespindle poles. Karyokinesis and cytokinesis are tightly synchro-nized to ensure high fidelity of genomic information transfer.Classic experiments carried out on sand dollar eggs estab-lished the importance of the mitotic spindles and astral micro-tubules in setting up the contractile ring (1, 2). The centralspindle has been shown to be important for the completion of cytokinesis in several organisms, including  Dictyostelium  (3). Although a number of proteins have been shown to be associated with the mitotic spindle and implicated in cytokinesis (4–6), themolecular clues for the crosstalk between the spindle andcortical midzone during mitosis remain elusive.Membersofthemitotickinesinfamilyhavebeenshowntoplaykey roles in the assembly and function of the mitotic spindle. Inmammalian cells, MKLP1 is required for the formation of themidbody matrix and the completion of cytokinesis (7, 8). Similargene disruption experiments of MKLP1 orthologs in zebrafish(9),  Drosophila  (10), and  Caenorhabditis elegans  (11) also resultin a cytokinesis failure. In most cases, furrow ingression isinitiated, but cytokinesis fails to complete. Thus, MKLP1 is a keyplayer in passing information from the mitotic spindle to thecleavage furrow.Myosin II is a major component of the cellular machineryresponsible for cytokinesis (12, 13). However, little is knownabout how myosin is translocated to the cleavage furrow duringmitosis. Using  Dictyostelium  as a model system, our laboratoryhas been studying myosin II regulation and localization duringcell division. We have now identified a mitotic kinesin-likeprotein (Kif12), which, like MKLP1, is required for cells toundergo mitotically linked cytokinesis. Using live-cell imaging, we show that Kif12 is required for normal myosin II localizationduring mitosis. We show that Kif12 also is required for normalnuclear separation during late anaphase and telophase. Materials and Methods Cell Culture.  Dictyostelium discoideum  AX2 (wild-type) cells weregrown in axenic HL5 medium supplemented with penicillin andstreptomycin at 22°C. Kif12-null (   kif12 ) cells were grown withadditional 10   g  ml blasticidin S hydrochloride. Wild-type and   kif12  cells carrying GFP-myosin II and other plasmids weregrown in medium containing penicillin, streptomycin, and 10  g  ml G418. The cells were grown in plastic Petri dishes. Cellsin suspension were grown in conical flasks on a rotating shakerat   150 rpm. Identification and Cloning of the  kif12   Gene from  Dictyostelium  .  Weidentified a gene (  kif12 ) in the  Dictyostelium  genome (www.dictybase.org) through a sequence homology search ( BLAST , www.ncbi.nlm.nih.gov  blast) that compared mitotic kinesinsfrom various organisms. cDNA clones for  kif12  were obtained byRT-PCR from a total RNA preparation of   Dictyostelium . A 4.5-kb sequence corresponding to the full length of   kif12  wascloned from  Dictyostelium  by using the 5   and 3   primers ATGGATCCATGAAAGATTATATTTCATCTCC and GT-TCTAGACGAGGTTTAGTCCTAAAGTTTTACGTGG, re-spectively. The full-length  kif12  was cloned further into a pTX-based vector (14). While this work was being completed, thisgene and five other mitotic kinesins were reported in the  Dictyostelium  genome (15). The Knockout Construct for the Disruption of the  Dictyostelium kif12  Gene.  A construct for a gene knockout was created, as describedin ref. 16. Two fragments of    500 bp each at both ends of the  kif12  gene were amplified.Fragment 1 (near the N terminus) was amplified from the  kif12  gene by using the 5   primer bam43531f, ATGGATCCG-GCATATGGTGTAACAAATCTGG and the 3   primer xba43532r, TGTCTAGACCTTGTTCAACAATATCAC-GTGCATCC. Fragment 2 (at the C terminus) was amplified byusing the 5  primer hin43532f, GTAAGCTTCCAACTAAACT-TCAACCACATTCATCACC and the 3   primer xho43532r,GTCTCGAGCGAGGTTTAGTCCTAAAGTTTTACGTGG.The oligonucleotides used for amplification contained appro-priate restriction sites to be cloned into pSP72-BSR [containingthe gene conferring resistance to blasticidin (17)]. Briefly,fragment 1 of   kif12  was cloned into pSP72-Bsr at the 5   end of the blasticidin gene, and fragment 2 of   kif12  was cloned into the3   end of the blasticidin gene, generating pSP72-fragment1-Bsr-fragment2. Through homologous recombination, nearly 70% of  Freely available online through the PNAS open access option.*To whom correspondence should be addressed. E-mail: jspudich@stanford.edu.© 2004 by The National Academy of Sciences of the USA www.pnas.org  cgi  doi  10.1073  pnas.0407304101 PNAS    November 23, 2004    vol. 101    no. 47    16519–16524       C      E      L      L      B      I      O      L      O      G      Y  the gene was deleted. The deletion contained the catalytic headdomain of kinesin, the neck linker, and almost the entire taildomain (except the last 200 amino acid residues), which werereplaced with a blasticidin-resistance marker flanked on bothsides with an actin promoter and terminator sequences. Transformation of  Dictyostelium   and Selection of the KnockoutClones.  The knockout construct was digested from pSP72-fragment1-BSR-fragment2 by using unique restriction sites(  Bam HI and  Xho I) at the 5   and 3   ends of the construct toseparate the fragment1-BSR-fragment2 from the pSP72 plas-mid. The linearized knockout construct was then transformedinto wild-type cells by electroporation. Transformed cells wereselected on Petri plates with HL5 medium containing penicillin,streptomycin, and 10   g  ml blasticidin. Individual clones werepicked and transferred into 24-well plates. The colonies werepicked and grown on 150-cm plates for obtaining genomic DNA for further analysis. Southern Blot Analysis.  Genomic DNA from each mutant cell lineand wild-type parental control cells was prepared and digested with the restriction enzyme  Acc I and processed for transfer to anylon membrane by using standard methods described in ref. 16.Fragment 1 and fragment 2 (Fig. 6, which is published assupporting information on the PNAS web site) were used asprobes and were labeled by using the Gene Images AlkphosDirect labeling kit (Amersham Biosciences). The bound probes were detected with CDP-Star chemiluminescent detection re-agent (Amersham Biosciences) after an exposure of 1 h onhyperfilm MP imaging film (Amersham Biosciences). Expression of Protein in  Dictyostelium  .  For the expression of GFPand Flag-tagged proteins in  Dictyostelium  cells, the full-lengthsequence encoding Kif12 was amplified by PCR from the cDNA clones and ligated into pTX-based vectors that are under thecontrol of the actin 15 promoter (14). Transformants wereselected and maintained at 7.5–10   g  ml G418. Immunofluorescence and Live-Cell Microscopy.  D. discoideum  wild-type and   kif12  cells (HS 50) were cultivated on coverslips or inoptical coverglass chambers (Lab-Tek). For immunostaining,the cells were fixed with 2–4% formaldehyde for 5 min and thenincubated in methanol for 5 min at   10°C. Subsequently, thecells were stained with 4  ,6-diamidino-2-phenylindole (Molecu-lar Probes) to show nuclei.For live-cell imaging, the cells were cultivated at 22°C inoptical coverglass chambers and the nutrient medium was re-placed by imaging buffer (20 mM Mes buffer, pH 6.8, containing0.2 mM CaCl 2  and 2 mM MgSO 4 ).The cells were observed with a 64   1.3 numerical apertureobjective on an Axiovert microscope (Zeiss). Images werecollected by using  METAMORPH  software (Universal Imaging,Downingtown, PA), and the images were processed with  PHO-TOSHOP  (Adobe Systems, San Jose, CA) and  IMAGEJ  (NationalInstitutes of Health). Live-cell imaging was performed by col-lecting images at 30-s intervals. Results Identification of  kif12   from  Dictyostelium  . Weidentifiedandclonedthe  kif12  gene from  D. discoideum  (Fig. 7, which is published assupporting information on the PNAS web site). The  Dictyoste- lium  genomic database was screened by using protein sequencesimilarity to the MKLP1 mitotic kinesin family from otherorganisms. The sequence of the  kif12  gene encodes a protein withamolecularmassof168kDathatconsistsofakinesinmotordomain near the N terminus, with an N-terminal extension of   100 residues (Fig. 6). The motor domain is followed by acentral stalk and then a C-terminal tail region.The motor domain of Kif12 shows the highest degree of sequence homology with the head domain of the mitotic kinesinMKLP1. The full-length sequence of   Dictyostelium  Kif12 isavailable through GenBank (accession no. AY484465), and themotor domain has sequence similarity to human (50%),  C. elegans  (56%), and zebrafish (56%) MKLP1. However, outsidethe motor domain, Kif12 does not show significant homology toMKLP1, any other mitotic kinesin-related proteins, or conven-tional kinesins. Disruption of the  kif12   Gene.  To examine the cellular function of Kif12, we deleted the region of the  kif12  gene that codes for themotor domain, neck linker, and most of the tail domain (Fig. 6)by homologous recombination using a knockout construct (16,17). Briefly, a gene conferring resistance to blasticidin wasinserted as a marker between two regions of the  kif12  gene, onenear the N terminus and the other at the C terminus. Thisconstruct was transformed into wild-type  Dictyostelium  (AX2)cells, and the resulting colonies were selected for blasticidinresistance. Deletion of   kif12  was confirmed by Southern blotanalysis (Fig. 1  A ). By using the same construct,  kif12  also wasdeleted in an independent strain of   Dictyostelium  (Orf   ).  kif12   Cells Fail to Undergo Cytokinesis.  Compared with wild-typecells, which predominantly were mononucleated,    kif12  cellsgenerally were large and multinucleated when grown on asurface (Fig. 1  B ). The    kif12  cells were unable to divide in acell-cycle-dependent manner and remained multinucleated dur-ing the vegetative cycle. When grown in suspension, the   kif12 cells showed a severe cytokinesis defect (Fig. 1 C ), and the cellsdid not survive for more than a couple of days in suspendedculture. The    kif12  cells lacked the ability to maintain a rela-tively homogeneous cell volume (Fig. 8, which is published assupporting information on the PNAS web site).Myosin II is required for division of   Dictyostelium  cells insuspension (cytokinesis A), but  Dictyostelium  cells lacking themyosin heavy chain gene (  mhcA  ) can undergo mitosis-coupleddivision in the absence of myosin II on a surface by an adhesion-dependent process (cytokinesis B) (18–20). The    kif12  cellsfailedtodividebyusingcell-cycle-dependentcytokinesisbothona surface and in suspension, suggesting that this gene is commonto both cytokinesis A and cytokinesis B in  Dictyostelium . On asurface, the    kif12  cells could pull themselves apart into frag-ments and undergo mitosis-independent, traction-mediated cyt-ofission (21). When cells divided in this way, they typicallydivided asymmetrically, forming smaller cells that survived aslong as they captured at least one nucleus. The   kif12  cells that were mononucleated showed various defects during mitosis.Some    kif12  cells got arrested at metaphase, and the cellsremained rounded for a very long time. Other    kif12  cellsshowed some furrow ingression during late mitosis, but thefurrow ingression did not progress to completion, and the cellsfailed to undergo complete cytokinesis (Movie 1, which ispublished as supporting information on the PNAS web site). Thefurrow ingression frequently was asymmetric. Occasionally, when the cleavage furrow formation went nearly to completion,the two daughter cells retracted and fused back to form a singleparent cell. The same deletion phenotype was observed withboth the AX2 and Orf   strains.  kif12   Cells Are Complemented by Extrachromosomal Expression ofKif12.  Two constructs were made to express N-terminal fusionproteins with full-length Kif12 in  Dictyostelium .  Flag  -  kif12  and GFP  -  kif12  were made and transformed into    kif12  cells. Both  kif12  constructs fully rescued wild-type behavior in   kif12  cells(Fig. 1  B  and  C ). 16520    www.pnas.org  cgi  doi  10.1073  pnas.0407304101 Lakshmikanth  et al.  Localization of GFP-Kif12 Is Cell-Cycle Regulated.   kif12  cells trans-formed with  GFP  -  kif12  were monitored for cellular localizationof GFP-Kif12. During interphase, most of the GFP-Kif12 waslocalized in punctate spots associated with nuclei (Fig. 2). As thecells entered metaphase, GFP-Kif12 appeared to completelyleave the nucleus and was found diffuse in the cytoplasm. Uponthe onset of anaphase, GFP-Kif12 localized to the centrosomesand along the spindle fibers. After anaphase, the GFP-Kif12showed some concentration in the midbody (Movies 2 and 3, which are published as supporting information on the PNAS website). Localization of Myosin II in   kif12   Cells.    kif12  cells were trans-formed with GFP-myosin II, and the cells were grown on asurface. These cells were monitored, and their attempts at celldivision were compared with the wild-type cell-division processby using GFP-myosin II localization as a marker for cytokinesis,as shown in Fig. 3  A .The nuclear position was easily measured because it appearsrelatively dark because of exclusion of the GFP-myosin II fromthe nucleus. Wild-type cells completed cell division (Movie 4, which is published as supporting information on the PNAS website)   200 s after anaphase, whereas the    kif12  cells attempteddivision 3–6 times longer after anaphase before failing to divide(Fig. 3). The internuclear distance and the width of the cleavagefurrow were measured as a function of time. Nuclear separationoccurred in the    kif12  cells, but the rate was slowed compared with wild-type cells, and the separation was no longer linear withtime (22) (Fig. 3  B ). Thus, Kif12 may work in concert with othermitotic kinesins to provide the normal rate of karyokinesis. Forexample, KLP61F, a  Drosophila  bipolar kinesin, and Ncd, aminus-end-directed kinesin, have been implicated in a similaranaphase role (23). Dynein also may play a role in this processby pulling on astral microtubules at the poles of the cell (24, 25).Unlike wild-type cells,    kif12  cells expressing GFP-myosin IIfailed to localize GFP-myosin II to the cleavage furrow (Fig. 4  A andMovie5,whichispublishedassupportinginformationonthePNAS web site). The line scan of fluorescence intensity of GFP-myosin across the width of the cleavage furrow indicatedthe lack of accumulation of myosin II in the furrow cortex (Fig. 4  B ). Discussion In this study, we successfully cloned the  kif12  gene and showedthat Kif12 plays a critical role in cytokinesis in  Dictyostelium .Localization of Kif12 in interphase cells occurs predominantly inregions associated with the nucleus. Kif12 has two nuclearlocalization signals (Fig. 6).In budding yeast, nucleoli serve as storage depots for regula-tory factors, including Mdm2, Pch2, Sir2, and Cdc14, whichregulate the onset of anaphase and telophase. These factors areknown collectively as the mitotic exit network (26). It has beenshown  in vitro  that cdk1  cyclin B phosphorylates the motordomain of ZEN-4, a  C. elegans  MKLP1 ortholog, and thusreduces its affinity for microtubules (27). However, a constitu-tively dephosphorylated form of ZEN-4 localizes to the centralspindle during mitosis (27). Phosphorylation by cyclin B seemsto account for the release of mitotic exit activator cdc14 from the staining (with 4  ,6-diamidino-2-phenylindole) for the parental wild-type (wt)strain( a and b ),the  kif12 strain( c  and d  ),andthe  kif12 strainrescuedwithGFP-Kif12 ( e  and  f  ). ( C  ) Effect of deletion of  kif12  on cytokinesis of  Dictyoste-lium.Left  showsthecomparisonofthenumberofnucleipercellwhengrownon a surface for wild-type (black bars) and   kif12  (hatched bars) cells and  kif12 cellscomplementedwith kif12 (graybars).Ineachcase, n  200. Right  shows the comparison of the number of nuclei per cell when grown insuspension. Fig. 1.  Establishing the  kif12  knockout in  Dictyostelium . (  A ) Genomic DNAfromtheparentalstrainandtwoindependentknockoutstrainswassubjectedto restriction digestion by  Acc  I and used for Southern blot analysis. A 500-bpDNAfragmentfromtheNterminusofthegenewasusedasaprobe(indicatedin Fig. 6). Lane a shows a 4.6-kb band, expected for the parental strain. Lanesbandc,containingDNAfromstrainsKO1(HS50)andKO2(HS51),respectively,showa3.4-kbband,whichisexpectedfromhomologousrecombinationwiththeknockoutconstructshowninFig.6.( B )Morphologyof Dictyostelium cells.The phase-contrast image is shown in  a ,  c  , and  e ;  b ,  d  , and  f   show nuclear Lakshmikanth  et al.  PNAS    November 23, 2004    vol. 101    no. 47    16521       C      E      L      L      B      I      O      L      O      G      Y  nucleolus (28). It is possible that cdc14 dephosphorylatesMKLP1, causing it to bind to microtubules, which results inlocalizationofmitoticmachinery(includingINCENP-AuroraB)to the spindle (29).Previous studies showed that the localization of   Dictyoste- lium  myosin II to the cleavage furrow region is independent of its interaction with actin (30, 31). In wild-type cells, aftermetaphase, myosin II localizes to the cell cortex and then isdepleted at the poles by the action of myosin heavy chainkinases (MHCKs) (32). Bipolar thick filaments of myosin tailscarrying the regulatory light chain but having the essentiallight chain and catalytic domain replaced by a GFP molecule were found to accumulate in the cytoplasmic domain of thecleavage furrow region, rather than in a circumferential cor-tical ring in the furrow (30). These observations would beconsistent with myosin II bipolar thick filaments being pulledto the center of the cell along spindle microtubules by wayof the myosin tail domain to accumulate in the cytoplasmicregion of the furrow. Activation of the myosin II motordomains then would allow the thick filaments to interact withactin filaments attached to the cortical membrane, resulting inpulling the filaments into the cortex in the furrow region. Theactivity of MHCK A and MHCK C in the polar regions of thedividing cell could release myosin II from the poles (33), thusbiasing myosin II localization to the central cortex of thedividing cell.In  Dictyostelium , the nuclear membrane does not completelybreak down during mitosis. The centrosomes are positioned onthe outside of the nuclear membrane, and a central spindle of overlapping microtubules is intranuclear throughout mitosis(Fig. 5  A  and ref. 3). The role of Kif12 in myosin localizationcould be relatively indirect and may be the result of complex structural, signaling, and regulatory mechanisms. Kif12, forexample, may play a role in the cellular distribution of mech- Fig.2.  LocalizationofGFP-Kif12inlive  kif12 cellsundergoingcytokinesis. Upper  showstheGFPfluorescenceduringvariousstagesofmitosis,and Lower  showsthe corresponding phase-contrast images. Fig.3.  Characterizationof  kif12 cellsexpressingGFP-myosinII.(  A )Time-lapseimagesshowthelocalizationofGFP-myosinIIinwild-type(wt)and  kif12 cells.( Upper  )Wild-typecellsundergoingcytokinesis.GFP-myosinIIislocalizedstronglyatthecleavagefurrow(representativeof20cellsimaged).( Lower  )  kif12 cellsexpressingGFP-myosinIIatastagesimilartothatofthewild-typecells.NodistinctlocalizationofGFP-myosinIIisobservableatthecleavagefurrowinthe  kif12 cells(representativeof30cellsimaged).Timeisindicatedinseconds.( B )Internucleardistanceandwidthofthecleavagefurrowwithtimeinwild-typeand  kif12 cells.  Left   shows the internuclear separation, and  Right   shows the width of the cleavage furrow. Five cells were averaged to obtain the wild-type nuclearseparationdataandthewild-typecytokinesisdata.Thewidthofthecleavagefurrowisshownforrepresentative  kif12 cellsbecausetherewasalargevariationin the cleavage furrow width, unlike the situation for wild-type cells, for which the average of six cells is shown. 16522    www.pnas.org  cgi  doi  10.1073  pnas.0407304101 Lakshmikanth  et al.  anoregulatory proteins, which collectively ensure faithful celldivision coupled to mitosis. However, it is worth considering thesimplest hypothesis: that Kif12 may be transporting myosin IIalong mitotic extranuclear microtubules toward the center of thecell (Fig. 5  B ). Kinesins are known to transport vesicular cargo,and roles of membrane insertion during cytokinesis and depo-sition of special lipids in the region of the cleavage furrow havebeen documented recently (34, 35). Thus, this simplest model of Kif12-driven myosin translocation could be vesicle-mediated, with the vesicles being inserted into the cleavage furrow mem-brane during furrow formation (36). We thank Dr. Arturo De Lozanne (University of Texas, Austin) for thePSP72 plasmid construct, Dr. Gunther Gerisch (Max-Planck-Institut fu¨rBiochemie, Martinsried, Germany) for the GFP-  -tubulin construct,Natalie Dye for extensive help in collecting the immunofluorescencedata, Sara Ocon for help during the course of the work, Tom Purcell forhelp on the model figure, and other members of J.A.S.’s laboratory forcritical comments on the work. G.S.L. is supported by a Damon RunyonCancer Research Foundation Postdoctoral Fellowship. This work wassupported by National Institutes of Health Grant GM46551 (to J.A.S.). 1. Rappaport, R. (1961)  J. Exp. Zool.  148,  81–89.2. Rappaport, R. (1996)  Cytokinesis in Animal Cells  (Cambridge Univ. Press,Cambridge, U.K.).3. McIntosh, J. R., Roos, U. P., Neighbors, B. & McDonald, K. L. (1985)  J. CellSci.  75,  93–129.4. Glotzer, M. (2003)  Curr. Opin. Cell Biol.  15,  684–690.5. Straight, A. F. & Field, C. M. (2000)  Curr. Biol.  10,  R760–R770.6. Robinson, D. N. & Spudich, J. A. (2000)  Trends Cell Biol.  10,  228–237.7. Matuliene, J. & Kuriyama, R. (2002)  Mol. Biol. Cell  13,  1832–1845.8. Kuriyama, R., Gustus, C., Terada, Y., Uetake, Y. & Matuliene, J. (2002)  J. Cell Biol.  156,  783–790.9. Chen, M. C., Zhou, Y. & Detrich, H. W., III (2002)  Physiol. Genomics  8,  51–66.10. Minestrini, G., Harley, A. S. & Glover, D. M. (2003)  Mol. Biol. Cell  14, 4028–4038.11. Powers, J., Bossinger, O., Rose, D., Strome, S. & Saxton, W. (1998)  Curr. Biol. 8,  1133–1136.12. Mabuchi, I. & Okuno, M. (1977)  J. Cell Biol.  74,  251–263.13. Satterwhite, L. L. & Pollard, T. D. (1992)  Curr. Opin. Cell Biol.  4,  43–52.14. Levi, S., Polyakov, M. & Egelhoff, T. T. (2000)  Plasmid  44,  231–238.15. Kollmar, M. & Glockner, G. (November 27, 2003)  BMC Genomics , 10.1186  1471-2164-4-47.16. Manstein, D. J., Titus, M. A., De Lozanne, A. & Spudich, J. A. (1989)  EMBO J.  8,  923–932.17. Wang, N., Wu, W. I. & De Lozanne, A. (2002)  J. Cell. Biochem.  86,  561–570. Fig. 4.  Observation of early furrowing in cells expressing GFP-myosin II. (  A ) Left   shows five live wild-type (wt) cells undergoing cytokinesis. GFP-myosin IIlocalization is observed prominently in the cleavage furrow.  Right   showsattemptsofcytokinesisinlive  kif12 cells.ThecellsfailtolocalizeGFP-myosinII to the cleavage furrow. ( B ) Line-scan analysis of fluorescence intensity ofGFP-myosin II across the width of the cleavage furrow for each cell shown in  A . The  y   axis shows the normalized fluorescence, and the  x   axis shows thescanning coordinate in micrometers. Fig. 5.  Progression of a live cell during cytokinesis and model for spindle-poleandvesiclemovementduringmitosis.(  A ) Top showsthelocalizationandreorganization of myosin II during cytokinesis in a wild-type cell expressingGFP-myosin.  Middle  shows GFP-  -tubulin expressed in a wild-type cell under-goingcytokinesis. Bottom isaschematicthatshowsthelocalizationofmyosin(green) and tubulin (dark blue) during cytokinesis in  Dictyostelium  wild-typecells.Thepositionofthenucleiisindicatedinlightblue.( B ) Upper  showsKif12(orange) on microtubules (black) in the spindle region of a cell during an-aphase. The nuclear membrane does not completely break down duringmitosis of  Dictyostelium  and is shown in transparent light blue. The poles(light-green ovals) are separated, in part, by the action of Kif12 on theinterdigitating central spindle microtubules. Kif12 also transports vesicles(light-blue ovals) carrying mechanoregulatory factors, perhaps including my-osin II (green), on the spindle fibers. Chromosomes (blue) are being segre-gated bound to kinetochore microtubules.  Lower   shows a cell in late telo-phase.Thevesiclesdropoffinthecenterofthecellandtransferthesignalsforcytokinesis. Lakshmikanth  et al.  PNAS    November 23, 2004    vol. 101    no. 47    16523       C      E      L      L      B      I      O      L      O      G      Y
Similar documents
View more...
Search Related
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks